Alternative splicing is a common mechanism for eukaryotes toexpand their repertoire of gene functions. At least one estimateindicates that approximately 50 percent of human genes usealternative splicing, and approximately 15 percent of diseasecausingmutations involve aberrant alternative splicing. Differenttissues show remarkably different frequencies of alternativesplicing, with the brain accounting for approximately 18 percentof such events. Why might some tissues engage in more alternative splicingthan others?

Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…

A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…

Q: The hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region…

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: Phorbol esters have been observed to induce the transcription of AP-1–influenced genes. Explain how…

A: Signal transduction is a process in which signals from the extracellular level enter the…

Q: You have isolated a protein that binds to DNA in theregion upstream of the promoter sequence of the…

A: Positive regulation refers to the increased transcription of a gene by binding of a protein or a…

Q: . One way to determine where inside a cell a protein(protein X) normally localizes is to generate a…

A: The X-GFP gene can be produced by knocking in the coding sequences of GFP as compared to random…

Q: Alternative splicing takes place in more than 95% of the human protein-encoding genes with multiple…

A: In alternative splicing, a single pre-mRNA may be spliced in two or even more ways depending upon…

Q: Pre-mRNAs in mitochondria are converted to maturemRNAs through ______editing, which makes…

A: the RNA polymerase makes a complementary RNA transcript using the template strand of the DNA during…

Q: A single UASG regulates the expression of threegenes, all of which are adjacent: GAL7 and GAL10…

A: Transcription is the first process of gene expression. In this process, the information present in…

Q: vell. A study on this organism found that two mature mRNA molecules are produced for this gene. One…

A: Few points to understand mRNA processing --- In prokaryotes transcription and translation occurs…

Q: Before the technology existed to synthesize RNAmolecules of defined sequence like those in Fig.…

A: Hello there! As you have posted multiple questions, we are answering only the first three subpart…

Q: A genon wide analyst of human genome indicated that approximately 1500 genes encoded transcription…

A: Transcription factors These are proteins that are involved in the process of transcribing the…

Q: Amude cel and a skm cel both cartan the same 45 chromosomes, but express d fferent genes. In terms…

A: Muscle cells and skin cells are examples of differentiated cells. The functions of both cells are…

Q: You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate…

A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…

Q: (a) Did deletion of any of the possible control elements cause anincrease in reporter gene…

A: Insertion and deletion are naturally processes occurring within the DNA or mRNA sequence for…

Q: Suppose you have just determined the DNA base sequence foran especially strong promoter in…

A: An expression vector is a plasmid or virus and it used for gene expression. In gene expression, the…

Q: What region would provide cell type-specific expression of genes? region  What site would…

A: The mRNA is given in the figure. The mRNA undergoes the process of translation to produce protein.

Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced.Gcn4…

A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…

Q: Since it was deciphered four decades ago, somehave claimed that the genetic code must be a frozen…

A: The frozen accident may be regarded as the default code evolution hypothesis since the comparable…

Q: The human α-tropomyosin gene is alternativelyspliced to produce different forms of α-tropomyosinmRNA…

A: On chromosome 15 (68), the -tropomyosin gene (TPM1) is structured into 15 exons and produces a…

Q: You are studying an operon containing three genesthat are cotranscribed in the order hupF, hupH,…

A: Operon is a set of genes which are responsible for conduction of related functions. it is a feature…

Q: Alternative splicing is a common mechanism for eukaryotes toexpand their repertoire of gene…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: How is it possible that a given mRNA in a cell is found throughoutthe cytoplasm but the protein that…

A: The translation is a process of conversion of mRNA into specific amino acids in the cytoplasm of a…

Q: Cells go to great length to correctmistakes in the processes of DNAreplication, transcription,…

A: When Errors in Replication Become Mutations After the next cell division, incorrectly coupled…

Q: (d) Let's suppose (I'm not saying they are; you figured that out in the question above) that the…

A: The eukaryotic genes are interrupted. The pre-mRNA contains exons and introns. The introns are…

Q: One of the main lessons of this chapter is that severalbacterial genes are often transcribed from a…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: You have just gotten back the results from an RNA-seq analysis of mRNAs from liver. You had…

A: RNA-Seq which is expanded as RNA sequencing is described as a sequencing technique that makes use of…

Q: You have synthesized an enhancerless GFP reportergene in which the jellyfish GFP cDNA is…

A: The enhancer sequences are regulatory DNA sequences. These sequences when bound by specific proteins…

Q: ow that the human genome has been sequenced, we know that there are fewer than expected protein…

A: The genomes of most eukaryotes including Humans are larger and complex than those of prokaryotes.…

Q: What is the benefit of alternative splicing? Tho nolarit of a protein can be adiusted for other…

A: Messenger RNA or mRNA molecule is produced from DNA by the process of transcription. The mRNA…

Q: State whether each of the following would be likely to (generally) increase or decrease the…

A: Gene expression regulation involves the modification of both the DNA and the packaging proteins…

Q: The TBX20 transcription factor is important for the developmentof heart tissue. Deletion of the…

A: T-box transcription factor Tbx20 gene in mice is essential for prenatal cardiomyocyte proliferation…

Q: Many genes whose expression is turned on by DNAdamage have been isolated. Loss-of-function mutations…

A: The lex A gene encodes a repressor protein and is involved in controlling the DNA repair, inhibition…

Q: Each year in the United States, there are over 230,000 newcases of prostate cancer and almost 28,000…

A: Genetic screening is done for various types of cancer.

Q: To construct an “interactome” like the one shown inFigure 9-21, scientists identify all of the…

A: Introduction An interactome is the entire set of molecular interactions in a single cell in…

Q: Control of gene expression in eukaryotic cells occurs at which level(s)? Lütfen birini seçin: O a.…

A: Eukaryotic cells can be defined as the type of cell which consists of the nucleus enclosed in the…

Q: In eukaryotes, transcription initiation involves enhancersequences located far from the promoter. In…

A: Eukaryotic transcription is the lengthy process that eukaryotic cell uses to copy genetic…

Q: Scientists have exploited the siRNA pathway toperform a technique called RNA interference—ameans to…

A: Ribonucleic acid interference is the technique that can potentially inhibit the function of a…

Q: Some exons in the human genome are quite small (lessthan 75 bp long). Identification of such…

A: Alternative RNA splicing is a fundamental post-transcriptional regulatory process that results in a…

Q: Cro protein expression and activity may be activated in a prophage by a)lysogenic dominance b)rapid…

A: Role of Cro protein:                     The host SOS response triggers the prophage induction by…

Q: Research has demonstrated that the composition of a gene’s promoter can affect alternative splicing…

A: Alternate splicing is a regulated process in which a single gene that codes for multiple protein…

Q: In the human immune system, so-called B cells canmake more than a billion different types of…

A: The DNA is the genetic material for almost all the organisms except some viruses. The DNA has a…

Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4…

A:

Q: A single mutation in one of the transcription factors inProblem 33 results in a drastic reduction in…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: Explain how the miR-200 family of miRNAs behave as tumorsuppressorgenes. What happens when their…

A: MicroRNAs ( miRNAs) are a class of short, non-coding RNA molecules that have a substantial gene…

Q: iii) What does the mutation do to the TMEM16F protein? splicing is unaffected, truncated protein…

A: * Canine Scott syndrome  is an inherited blood clotting disorder found in dogs. *dogs with this…

Q: If Dr. Aikenhed wanted to see if there was mutation within the protein-coding sequence of the gene…

A: The technique which can be used to compare protein-coding sequence i.e the nucleotide sequence of…

Q: a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost…

A: The process in which the polymerization of ribonucleotides, guided by complementary base pairing…