All about RNA editing A. changing one or more nucleotides in the RNA transcript by deamination B. introducing premature stop codons C. altering amino-acid coding possibilities D. changing a splice site in a transcript E. self-splicing to generate the primary transcript А) А, В, С, D only в в, С, Е only с) А, В, С only A, B, C, D, E
Q: How does 2’-O-methylation protect rRNA and mRNA?
A: Ribosomal RNA (rRNA) experiences about 200 nucleotide modifications after transcription, the most…
Q: Between the respiratory and urinary systems, which would you say is easier to achieve homeostasis
A: Homeostasis is the condition of consistent internal, physical, and chemical circumstances kept up…
Q: primer
A: PCR- it stands for the polymerase chain reaction. it is used to make many copies of a specific…
Q: Which of the following is NOT a typical mechanism by which a proto-oncogene is converted to an…
A: Proto-oncogenes are healthy genes that are found in the cell. They play a very important role in…
Q: Recall that the alleles for blood groups are A, B, O, and that A and B are each dominant to O, and A…
A: The genetic makeup of living organisms is referred to as genotype. The total number of genes passed…
Q: Why isn’t cDNA synthetic
A: INTRODUCTION Deoxyribonucleic Acid, or DNA, is a molecule that holds the instructions that an…
Q: Explain the neutral theory of molecular evolution (20%) and how you use it as a null hypothesis to…
A: There are multiple evolutionary terms that helps in establishing a role in the molecular evolution.…
Q: Answer each question in 300 words: 1. What size and shape of quadrat would you use to measure (a)…
A: Introduction-This protocol provides standardized data on seagrass percent cover, species…
Q: 2. For an SLR disease trait, in a parental cross where the male is unaffected and female is…
A: The most frequent kind of lupus is systemic lupus erythematosus (SLE). SLE is an autoimmune illness…
Q: discribe the various measures of strength of biological materials
A: For the measurements of biological materials strength various type of unit are used... 1. Like ATP…
Q: Central self-tolerance in the immune system arises when maturing T cells in the thymus undergo…
A: Apoptosis is a process of natural cell death. T cells are matured in Thymus but are born in Bone…
Q: The normal flow of electrons through the electron transport chain is blocked by sodium azide. Which…
A: The citric acid cycle and electron transport chain is the aerobic stages of cellular respiration.
Q: How does we know that trees or plants are transpiring base on your experiment?
A: The physiological process by which water is lost in the form of vapour from the living tissues of…
Q: Briefly explain the generation and conduction of nerve impulse.
A: INTRODUCTION Neurons (also called neurons or nerve cells) are the fundamental gadgets of the brain…
Q: A dominant allele that arises from recurrent mutation is mildly deleterious. The fitness of…
A: A mutation is a change in an organism's DNA sequence. Mutations can occur as a result of errors in…
Q: Describe not just list 4 adaptations that allow plants to cope with these challenges, 2 for coping…
A: The transition of plants from water to land Liverworts are believed to be the first plants that…
Q: Briefly explain the generation and conduction of nerve impulse.
A: Introduction The nervous system is one such system that regulates and organises the entire body's…
Q: Since 1958, the levels of carbon dioxide in the earth's atmosphere increased from about 315 parts…
A: An ecosystem is composed of biotic and abiotic factors of the area.The biotic components include the…
Q: Which option is a nonrenewable source of energy Petroleum Sunlight Water Wind
A: We used energy from our environment to do verious work. For light, heat, current, industry we used…
Q: ich of the following urine osmolarities reflects a period of decreased ADH secretion? 301 mOm/L 201…
A: When the body's osmolality rises, the body produces antidiuretic hormone (ADH). This hormone…
Q: Calculate the estimated population size, N, given a study that initially marked 100 animals and…
A: (11) The method of estimation is called the Lincoln Index P = (N1 x N2 )/ R. P = total size of…
Q: Punctuated Equilibrium is a hypothesis that ... O suggests that evolution is not gradual but occurs…
A: Punctuated equilibrium is a hypothesis that evolution of a species is marked by sudden isolated…
Q: P+OcZ-Y+A+// P¬O+Z+Y+A+ i) The lac operon consists of three structural genes, lacZ, lacY and lacA.…
A: The lactose operon (also known as the lac operon) is a set of genes that are specific for the uptake…
Q: Angiotensin-converting enzyme inhibitors (ACE inhibitors) are used to treat high blood pressure.…
A: Angiotensin converting enzymes called age are produced by liver and helps to convert angiotensin I…
Q: Short Answer 1. A. You are crossing bunnies. The haplotype of a female bunny, Poppy, is as shown in…
A: The independent assortment of genes states that the alleles of different genes are assortment…
Q: How do Restriction Enzymes like EcoRI work?
A: Restriction endonucleases are the enzymes which is used to cut particular region of DNA . They make…
Q: Explain the various anthropogenic causes of the water cycle.
A: The water cycle, also hydrological cycle or the water balance, is the continuous water flow on,…
Q: Explain the signaling steps that take place after the EGF receptor is dimerized, up to the poiunt…
A: As per our company guideline we are supposed to answer only first question or only first 3 subparts…
Q: Describe and explain the major steps in the process ofwastewater treatment. How can artificially…
A: Introduction :- Wastewater treatment is the process of removing contaminants from wastewater and…
Q: What are the principle and basic concepts of NEGATIVE staining?
A: Introduction Staining is a technique for enhancing contrast in material, usually on a microscopic…
Q: Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain
A: Flavin Adenine Dinucleotide: It is a redox active coenzyme associated with various proteins, which…
Q: A 150₁ 100- Cell-to-cell transmission (Relative, %) U D SARS-CoV SARS-CoV-2 Cell-to-cell…
A: Covid Pandemic Covid-19 is the recent cause of pandemics globally. It is a viral infectious disease…
Q: 5
A: Answer cat ovary with labelling
Q: a certain family with both parents affected with Heberdon’s nodes, a single gene trait characterized…
A: There are many four different modes of inheritance autosomal dominant, autosomal recessive, X linked…
Q: My field is COSMETIC SCIENCE What information can be obtained from UV-vis Spectra and how this can…
A: Ultraviolet Visible spectroscopy (UV-Vis spectroscopy) is an analytical technique, which measures…
Q: Pyruvate kinase, a glycolysis enzyme
A:
Q: Discuss how the structural/chemical properties of fat affect its physical characteristics and…
A: Fats are one of the major dietary requirements for an organism apart from carbohydrates and proteins…
Q: Benzoic acid has an absorption maximum at 230 nm. Where do you expect (give a value) to see the…
A: The neutral benzoic acid is acidic in nature and at pH lower than 7 benzoic acid obtain high…
Q: Ant species work together to collect food and build the mounds they live within. This behavior…
A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…
Q: 2) Now you would like to raise antibodies to this protein of YFG. How could you use the pure protein…
A: Antibodies generate by the immune system in body against the antigen which is foreign particle…
Q: The definition of "lineage" is:
A: Lineage refers to a group of individuals that have descended from a common ancestor. They descend in…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: CGA codes for Arginine. GGA codes for Glycine. Since the protein being coded for is completely…
Q: Substance that moves the electrical field solely depends on the speed of the substance in the…
A: 1. Substance that moves the electrical field solely depends on the speed of the substance in the…
Q: If the G locus were 50 or more map units from the centromere, what types and proportions of gametes…
A: Introduction Recombination:- It is a process by which pieces of DNA are broken and recombined to…
Q: 10. In class we discussed 3 types of plant and animal defenses (not mimicry), name one and give an…
A: Introduction Mimicry is a developed connection between an organism and another thing, usually…
Q: Direction: Explain the following in paragraph form consists of at least five sentences Stomates…
A: The evaporation of water in the form of water vapour through the stomata is called transpiration.…
Q: What is biomass
A: Biomass is defined as the total quantity of plants in a particular area.
Q: Do the following mathematical calculations to figure out the work each hand did: Work = 1…
A: Introduction The relationship between two versions of a gene is referred to as dominant. Each parent…
Q: A heterozygous plant of AaBb genotype was testcrossed and gave the following results. Phenotypes…
A: A trait is a characteristic feature that is unique to particular individual . A dihybrid cross is a…
Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…
A: ANSWER) (a) finding the e-value of phage proteins The BLASTp helps to predict the function of phage…
Step by step
Solved in 2 steps
- me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.a QUESTION 7 Please read the paragraph regarding transcription termination and fill in the blanks with words from the word bank below (not all of the words will be used): Rat1 ATP Adenosine AAUAAA Rho TATA A-site RNA polymerase Uracil Rut site Guanosine Hairpin There are two known mechanisms of transcription termination in prokaryotes. One mechanism requires a protein complex called This protein complex binds to the which is located on the RNA that is being transcribed. This protein complex then moves toward the stalled RNA polymerase complex and unwinds the RNA from the DNA. A second mechanism for termination in prokaryotes requires an RNA termination sequence that contains a secondary structure called a followed by a string of nucleotides. Transcription termination for RNA Polymerase II in eukaryotes happens when the termination consensus sequence, is transcribed leading to cleavage of the mRNA 11-30 nucleotides downstream of the termination sequence. Once cleavage occurs, binds to…
- Biol 1406-Lec 17 - Gene Exp X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Question completion Status. Blackboard Learn Which of the following stater X 9. Which of the following statements about transcription is not true? In both prokaryotes and eukaryotes, pre-mRNA is modified after transcription by adding a 5' cap and a 3' poly-A tail and splicing out introns leaving coding exons. Paraphrasing Tool - QuillBot Your disk is almos Save space by optir O During transcription only one DNA strand called the template strand is read and rewritten by RNA polymerase with the template strand read in the 3' to 5' direction and the mRNA transcript synthesized in the 5' to 3' direction. O During initiation of transcription, RNA polymerase binds to the promoter region in the DNA, unwinds the DNA and binds together RNA nucleotides complementary to the template DNA strand. O During initiation of eukaryotic transcription, the promoter region contains a TATA box in which transcription…The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you pickedKindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCG
- QUESTION: Transcribe the gene. Write out the correct sequence of m RNA bases. Notice that this is the same gene as in B above. Recall that in RNA, thymine (T) does not exist and uracil (U) takes its place. 3' ССА TAG CÁC CTT GTC ACA ACG TGT TCG TAG ACA 1 3. 4. 6. 7. 8. 9- 10 11 AGG AAC АТА ATA GTT AAC CTT TTG ATA ACA ТТА ACT 12 13 14 15 16 17 18 19 20 | 21 inOriginal DNA Sequence: T A C G C A A A A A T C G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Mutated DNA Sequence # 1: T A C G C A A A A A T T G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Will there likely be any effects from the mutation? yes or no. Explanation: _________________________________ ______________________________________________________________________________________________What type of mutation is it? _________________________________________________________________Mutated DNA Sequence # 2: T A C G C A A A G A T C G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Will there likely be any effects from the mutation? yes or no. Explanation: _______________________________________________________________________________________________________________________________What type of mutation is it? _______________________________________________________________________Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCATGCGAT 5' Start site
- Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleFrom the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed