a. From the graph describe briefly, Hes1 gene regulation in normal and mutant cells in presence or absence of the Sirt1 protein? b. What type of functional protein do you think Sirt1 is? C. Describe two possible biological processes that the normal cell could regulate in order to decrease the amount of Hes1 mRNA and protein.
Q: Can you please help me by drawing a serie of schematic figures that demonstrates the information in…
A: Proteins undergo post-translational modifications to increase their functional diversity. The…
Q: In humans, bone cells and nerve cells have very different functions and produce different sets of…
A: it happens because of expression.
Q: Is the presence of oncogenic Ras necessary for transient inflammatory stimulation to induce chronic…
A: Cancer is disease in which there is uncontrolled proliferation of cell. In organisms, cell…
Q: After the initial Actualization of the Cit+ phenotype, there was another alteration to the A-3…
A: Bacteria are dynamically evolving microbes. Various experiments suggest the evolution process of…
Q: Suggest a direct experiment to prove that p53 binding at gene promoters affects the level of gene…
A: p53 is a protein responsible for tumor suppression and helps in regulation of the overgrowth of…
Q: Cancer-promoting mutations are likely to have different effects on the activity of proteins encoded…
A: Cancer is the unnatural and excessive proliferation of cells that becomes harmful to normal body…
Q: How would a mutation which prevented Gal3 from binding to Gal80 affect gene expression from the GAL…
A: Galactose metabolizing genes express themselves in the presence of galactose. Galactose is…
Q: Also, describe what happens when a nonsense mutation is introduced into the gene encoding…
A: Mutations- Change in the sequence & structure of genetic material. Mutation causing agents are…
Q: Explain why in cells that are genetically NF1–/–, basal levels of GTP-bound activated Ras are higher…
A: Neurofibromatosis type 1 (NF1) is a typical hereditary problem portrayed by various neurofibromas,…
Q: Identify the two general functions of the proteins encoded bytumor-suppressor genes.
A: Gene is the unit of heredity that is transferred from a parent to offsprings. Proto-oncogenes are…
Q: . Another class of suppressor mutations, not describedin the chapter, are mutations that suppress…
A: A missense mutation is a type of mutation in which the error is in a single base. It is also known…
Q: Define Suppressor Mutations.
A: Suppressor mutations are helpful for distinguishing new genetic sites that have an effect on a…
Q: You are studying a new gene that is expressed within the adipose tissue of humans during the…
A: "Genes" can store genetic information in the form of DNA, which may be converted into functional…
Q: in a fat cell what is the result of activation of genes by PPAR gamma/activator proteins binding?…
A: Peroxisome proliferator - activated receptor(PPAR) gamma is a nuclear receptor of subfamily 1,group…
Q: a. What is the expected phenotype of an a cell in which HMRa has been deleted? [Select]
A: HMR is a cryptic mating type gene site in yeast. The information from HMR is transferred by HO…
Q: Select the answer that correctly expresses a valid comparison between transcriptional regulation in…
A: Transcriptional regulation is far more complex in eukaryotes than in prokaryotes. Prokaryotic…
Q: B. Briefly describe how can RNA seq be used to quantify differential gene expression between two…
A: It is attainable by performing RNA-Seq with spike-ins, samples of ribonucleic acid at identified…
Q: (a) Did deletion of any of the possible control elements cause anincrease in reporter gene…
A: Insertion and deletion are naturally processes occurring within the DNA or mRNA sequence for…
Q: In the bacterium,Martian coli, it was discovered that the lac operon is positively regulated.…
A: Operon is a functional unit of DNA that consists of cluster of genes under control of promoter.…
Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4…
A: Protein synthesis is the process in which cells make proteins. It occurs in two stages of…
Q: ith examples explain the importance of Non-coding ribonucleic acid interference in regards to gene…
A: A DNA sequence's genes are translated into amino acid sequences during the process of gene…
Q: With age, somatic cells are thought to accumulate genomic "scars"as a result of the inaccurate…
A: Answer given below..
Q: What DNA chemical modification can change the expression level of a target gene without sequence…
A: Introduction Epigenetics refers to the heritable or non-heritable changes in gene expression,…
Q: What is cell differentiation? Discuss the role of myogenic bHLH proteins in the differentiation of…
A: Proteins are the building blocks of the body and they are composed of chains of amino acids. Amino…
Q: Protein levels and mRNA levels for a particualr gene don’t always match. For example, the GCN4 gene…
A: Protein level and mRNA level for a particular gene do not always match because proteins are only…
Q: We know that eukaryote gene regulation can occur at any point in the process of gene expression.…
A: Given: We know that eukaryote gene regulation can occur at any point in the process of gene…
Q: Describe error prone polymerases and the process of translesion synthesis (TLS). In regards to tumor…
A: Translesion synthesis (TLS) is a method of overcoming stopped replication in which particular…
Q: (a) Did deletion of any of the possible control elements cause areduction in reporter gene…
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. DNA…
Q: Suggest a mechanism by which ARF leads to p53 build-up.
A: p53 protein gets activated when there is a damage in DNA sequence which can be induced by any other…
Q: Which of the following is not a possible outcome of changing the epigenetic code? a) exposure of…
A: * Epigenetic code is an defining code in eukaryotic cells in which each cell consist specific…
Q: Describe how mutations in genome maintenance factors promote tumorigenesis. Why would inactivation…
A: The cells are basic units of life. When any mutation in the gene takes place due to any radiation or…
Q: Based on the labels you should be able to recognize the characteristic structure depicted below and…
A: Introduction The Process Of Turning Nucleic Acid Information Into Amino Acids Is Known As…
Q: Discuss the mechanisms by which transcription factors influence the reprogramming of somatic cells…
A: Somatic cells are similar to human beings in that they develop to fulfill a specific purpose in…
Q: a. How do you think the PLAT gene expression is specifically regulated only in the endothelial…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Discuss the following argument: “if the expression of every gene depends on a set of transcription…
A: The process by which a gene gets turned on in a cell to make proteins is termed as gene expression.…
Q: Protein levels and mRNA levels for a particualr gene don’t always match. For example, the GCN4 gene…
A: Gene expression techniques such as PCR (polymerase chain reaction), microarrays and some assays such…
Q: What would happen to an insulator (for example, like the ICR between the Igf2 and H19 genes) if it…
A: Insulator are cis-regulatory elements. Upon binding by insulator binding proteins, they prevent…
Q: The binding of a small effector molecule, protein-protein interactions, and covalent modifications…
A: Transcription factors that bind to regulatory elements are called as regulatory transcription…
Q: Which of the type(s) of suppressors you put for part a will help to identify interacting proteins,…
A: Protein Interaction: Protein interaction when two or more proteins come into physical contact in a…
Q: If p63 can bind to the same promoter elements as p53, why would it be considered an inhibitor of…
A: Promoters are DNA sequences that function as a kind of "On" switch to start the biological process…
Q: Consider the example that actin mRNA localization is important for fibroblast migration. What would…
A: it is required for cell proliferation.
Q: Why is it adaptive for the structural genes for using lactose to be under the control of a single…
A: Each cell can adjust to its surroundings to the best of its abilities. This adaptability is achieved…
Q: Figure 2 illustrates how Pitx1 transcription is regulated in different tissues. The center image is…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: a. Would you expect a cell to continue or to stopdividing at a nonpermissive high temperature if…
A: The normal genes have various forms that can grow normally at low temperature and have an abnormal…
Q: Describe what would happen to the lac operon in a low-lactose environment and in a high lactose…
A: LacZ (encodes beta-galactosidase), lacY (permease), and lacA (trans-acetylase) are the three genes…
Q: The gene Igf2 for the insulin-like growth factor (IGF) promotes growth hormone production and cell…
A: The insulin-like growth factors are the proteins with high sequence similarity to the insulin. They…
Q: For each of the ff. scenario, state whether the gene is up- or down-regulated and briefly explain…
A: Up-regulation of gene expression refers to the increased expression of a gene by increasing the…
Q: Describe the common signal transduction event that is perturbed by cancer-promoting mutations in the…
A: Neurofibromatosis type 1 (NF1) is a genetic disorder that runs in families. Peripheral…
Step by step
Solved in 3 steps
- g protein D. Growth factor receptor ng Tool 0 Q ing C. Growth factor-binding protein D. Growth factor receptor E. Transcription activator A child with retinoblastoma is found to have a 13q14 deletion. The Rb gene, which resides at this locus, produces which kind of tumor-associated protein? A. Cell cycle regulator B. Growth factor ㅂ분 요 9 12 W □ @ 2 C Edit in Paint 8 60 8 FocusProtein mutations that result in a hyperproliferative (sustained proliferative signaling/uncontrolled growth signals) cell phenotype can be classified as a__E VG ✓H NA MATEN Match each letter (A through G) to its description. B A ya pada saat ada para a H F காலிமாம்ம் P S —— 1. Receptor 2. RNA 3. Lysosome 4. DNA 5. Ribosome 6. Ligand 7. Kinase domain 8. Nucleus 9. Mitochondria 10. Phosphorylated transcription factor 11. Dephosphorylated transcription factor 12. Plasma membrane
- You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC AAGCTCGAGAGCAСCAGCTСТАТGCGСТАСТАТААТGAССАКТАТАСССТАCGTGATAG 5" 3' RNA promoter polymerase 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? 4b. What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' --- 4c. What are the first 5 amino acids encoded by this gene? )Note - there is a codon table available at the beginning of this exam. N' C' 4d. Will translation stop at the UAA which begins at position 41? Explain your logic 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new…You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 AGATACGCGATGATATTACTGCTA AAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАССССТАCGTGATAG 3' TТCGAGCTCTСGTCGTCGAGA ПААТАТСGGGATGCАСТАТ С 5' RNA promoter polymerase Practice Question 4 G) You also study the expression of different mutants for this gene. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? For mutant C answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any)…
- You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGATATTАСТGGТААТАТСGGGАTGCАСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇECCTACGTGATAG ΤΑTC promoter RNA polymerase Practice Question 4 C) What are the first 5 amino acids encoded by this gene? N' C' ribosomeWilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a transcription factor. You have identified a novel variant in WT1: Arg422Pro. You have control cells and cells that have been engineered to carry the homozygous WT1 p.Arg422Pro mutation. You want to assess effects of this mutation on a variety of endpoints. For each endpoint listed below, choose the one technique is best suited to answer the question. Choose from: array CGH, qRT-PCR, qPCR, RNA-seq, FISH, in situ hybridization, western blot, immunostaining, WT1 ChIP-seq, WT1 ChIP-PCR, ATAC-seq, 3C Endpoint Technique? WT1 protein amount (quantitative) Western blot WT1 protein binding to all enhancers, genome-wide Chip-seq WT1 mRNA amount (quantitative) WT1 protein subcellular localization Quantitative assessment of all mRNAs in these cells (genome-wide) RNAseq Chromatin interactions between a specific WT1 chromatin binding site (identified above)…4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5’ promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).
- Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.Metabolic pathways can be switched on or off by hormones only. 2.In epigenetics, the chemical tag ethyl group can result in the inhibition of gene expression.ABOUT Phenylketonuria Explain Potential technical issues and limitations of PCR technology are mentioned Correct information about tissue that can be used to test for a genetic disease and justification of tissue selection Detailed information about the position (exact base pair number) of the new mutation relative to the sequence of the PAH gene. Numbering is based on the start of transcription of the PAH gene. PLEASE ANSWER ALLLL PLEASEESuppose that you have cancer cell line X was treated with drug Y toincrease the expression levels of protein Z which is a tumorsuppressor gene. (no need for this qustion)Explain How can you study protein Z in these cells? (needed)