A sloppy Python programmer wrote the following code, which is supposed to find the longest line of text in the file 'test.txt' and print it to the screen (without thetrailing newline character).As you will notice, the code contains syntax and/or logical errors. Select all lines that exhibit errors.longest size, longest_text = 0,with f = open("test.txt", "r"):for line in f:if len(line) < longest_size:longest size += 1longest text = line.rstrip("\n")print (f" longest line: \"{longest_text}\"")

1. {longest_size, longest_text = 0,}: A syntax error has occurred because the value assigned to…

Answered: A sloppy Python programmer wrote the…

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

python:def ohno_twozero(placeholder, statement): """ Question 1 - Regex You are typing a personal statement but accidentally used the number 0 instead of the letter o (the two are very close on the keyboard). After realizing this, seeing the mistake once does not bother you, but you absolutely cannot tolerate seeing it twice in a row. Therefore, you will need to replace any WORD where '00' shows up at any point with the given placeholder. Do not replace any NUMBER where 00 shows up. (e.g. '100' should stay as '100' and not be replaced with the placeholder). You may assume that when '00' shows up in a word, there will be at least one letter preceding it. Return the output string after making these changes. THIS MUST BE DONE IN ONE LINE. Args: placeholder (str) statement (str) Returns: str >>> ohno_twozero('epic', "I am n0w l00king at 500 t0tal h0urs 0n Super Smash Br0s.") "I am n0w epic at 500 t0tal h0urs 0n Super Smash…
Please code in python Write code that translates a name into (simplified) Pig Latin. (Please do not make this a 'real' Pig Latin translator.) Have your script ask the user for his or her name, which can comprise first, middle, and/or last parts. For each name part, move the first letter to the end of the part and append the letters "ay". Make sure that only the first letter of each word in your output is capitalized. You can use the split() method on the string to create a list of the name parts. Be sure that your script can handle one, two or three name parts separated by spaces. This will likely involve a loop. Your script should re-create the following example exactly: Enter your name: Paul LaskowskiOutput: Aulpay Askowskilay
IN PYTHON: Fill in the blanks to complete the “rows_asterisks” function. This function should print rows of asterisks (*), where the number of rows is equal to the “rows” variable. The number of asterisks per row should correspond to the row number (row 1 should have 1 asterisk, row 2 should have 2 asterisks, etc.). Complete the code so that “row_asterisks(5)” will print: * * * * * * * * * * * * * * * def rows_asterisks(rows): # Complete the outer loop range to control the number of rows for x in range(___): # Complete the inner loop range to control the number of # asterisks per row for y in range(___): # Prints one asterisk and one space print("*", end=" ") # An empty print() function inserts a line break at the # end of the row print() rows_asterisks(5) # Should print the asterisk rows shown above
Python please: Using the template code as a starting point, write a program that reads a string of letters as input and produces output that is either a number or an error message. The output number should equal the sum of the values assigned to the letters (defined below). The program should output the error message if the input contains any characters that are not defined below. The error message should read "Error: Input contains an invalid character. Valid input characters are A, E, J, O, T, Z, YY." Your template code creates a list of letters and assigns each letter a number value: Letter Number A 1 E 5 J 10 O 15 T 20 Z 26 YY 50 NOTE 1: The final value in the list (YY) is a two-letter combination that must appear in full in order to be considered valid input. NOTE 2: A space is not a valid input character. HINT: You may use string[start:end] to parse the input string and extract the numeric integer for the "YY" combination. Example 1: If the input is TEA the…
Modify the CharacterInfo class shown and included in the code editor to the right so that the tested character is retrieved from user input. An example of the program is shown below: Enter a character... R The character is R R is uppercase R is not lowercase After toLowerCase(), aChar is r After toUpperCase(), aChar is R R is a letter or digit R is not whitespace info> Do not edit the output statements. Task 01: Create the InputCharacterInfo class. Task 02: The InputCharacterInfo program displays the correct information for the input character.
This is for Python version 3.8.5 and please include pseudocode. A file named gang.txt is shown below. Write Python code that opens this file, reads only the first two lines, and prints “Penny is 19” gang.txt (contents of file) - please create on with the data provided in order to complete this question. Thank you! Penny 19 Kenny 20 Benny 21 Jenny 20
Python Coding-(On Pycharm Community Edition) Create a mini-lottery with TEXT ticket. The user is going to save three numbers in a text file - those three numbers are from 1-9. In Python, create a program that reads those three numbers from the text file (ticket) Use a random number generator to draw three random numbers Compare the text ticket and the random numbers. If they match number (see below), output the prize The numbers can be in any order the random numbers can be duplicates, so be careful how you count! This work in a similar way to mini-assignment number 48 - but you DO NOT have to write to a text file. Have the user enter the numbers into the text file. Append the numbers read from the text file to a list read each number from the list and compare it to the randomly generated numbers you come up with One number match - free ticket Two numbers match - $2.00 Three numbers match - $10.00 -you don't have to complete bonus, it would be great if you could-…
The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse python
The file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAA
The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcomposition
A python function opens file data.csv, reads the data from the file and spits the data into three columns, x, y and z. The data is then printed out. Function: f = open("data.csv ", "r") print('x\ty\tz'.format()) for row in f: temp = row.split(',') for cell in temp: print(cell,end='\t') print() data.csv contains: 1.2,2.1,1.1 2.3,3.2,0.6 0.7,1.9,0.1 1.8,2.5,0.3 4.6,2.7,0.9
Your program should use a loop to read data from a text file which contains students' names and 3 exam scores. The program should calculate the exam average for each student, determine the appropriate letter grade for that exam average, and print the name, average, and letter grade. After printing all this, you need to print the count of the total number of A's, B's, C's, D's, and F's for the whole class. The text file you need to use can be accessed using this link: scores.txt. Copy this file to the folder where your program will reside. The text file contains a list of 30 records, and each record contains a name and that person's 3 test scores. Each field is separated by a tab character. The first 2 records looks like this: Davis 88 92 84Wilson 98 80 73 and so on. Your program will need to open this file and read each line until the end of file. I recommend calculating a student's exam average and letter grade as you read the file, although this is not a…

SEE MORE QUESTIONS

Recommended textbooks for you

Database System Concepts

Computer Science

ISBN:

9780078022159

Author:

Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:

McGraw-Hill Education

Starting Out with Python (4th Edition)

Computer Science

ISBN:

9780134444321

Author:

Tony Gaddis

Publisher:

PEARSON

Digital Fundamentals (11th Edition)

Computer Science

ISBN:

9780132737968

Author:

Thomas L. Floyd

Publisher:

PEARSON

Database System Concepts

Computer Science

ISBN:

9780078022159

Author:

Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:

McGraw-Hill Education

Starting Out with Python (4th Edition)

Computer Science

ISBN:

9780134444321

Author:

Tony Gaddis

Publisher:

PEARSON

Digital Fundamentals (11th Edition)

Computer Science

ISBN:

9780132737968

Author:

Thomas L. Floyd

Publisher:

PEARSON

C How to Program (8th Edition)

Computer Science

ISBN:

9780133976892

Author:

Paul J. Deitel, Harvey Deitel

Publisher:

PEARSON

Database Systems: Design, Implementation, & Manag…

Computer Science

ISBN:

9781337627900

Author:

Carlos Coronel, Steven Morris

Publisher:

Cengage Learning

Programmable Logic Controllers

Computer Science

ISBN:

9780073373843

Author:

Frank D. Petruzella

Publisher:

McGraw-Hill Education

SEE MORE TEXTBOOKS