A replication fork is shown below. The primary enzyme that catalyzes replication is DNA polymerase That enzyme also has a proof-reading mechanis The leading strand would be the [ Select ] Helicase is a(n) enzyme [ Select ] double helix to the right side bottom strand top or bottom strand, since they are complementary. top strand left to right 3'

A replication fork is shown below. The primary enzyme that catalyzes replication is DNA polymerase That enzyme also has a proof-reading mechanis The leading strand would be the [ Select ] Helicase is a(n) enzyme [ Select ] double helix to the right side bottom strand top or bottom strand, since they are complementary. top strand left to right 3'

Name: A replication fork is shown below. The primary enzyme that catalyzes
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A replication fork is shown below. The primary enzyme that catalyzes replicationisDNA polymeraseThat enzyme alsohas a proof-reading mechanisThe leading strand would be the[ Select ]Helicase is a(n) enzyme[ Select ]left to rightdouble helix to the ri

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Similar questions

Given the diagram of the replication fork below, indicate the chemical group (5'-P, 3'-P, 3'-OH or 5'-OH) most likely to be found at the sites indicated below by the dots labeled A, B, and C.
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
Escherichia coli's chromosome has a replication origin called OriC. Draw a schematic diagram to show the specific DNA sequences that is essential for replication function scattering over a 245 base pair of Oric region.
For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 12. Is the top or bottom the leading strand? 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand. 14. What enzyme copies the DNA by adding DNA nucleotides? 15. What enzyme links Okazaki fragments together on the lagging strand?
For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand.
A replication fork is shown below. The primary enzyme that catalyzes replication is [ Select ] . That enzyme also [ Select ] The leading strand would be the [ Select ] . Helicase is a(n) [ Select ] In this picture, helicase would be moving in the [ Select ] direction. 3' > >
32)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…
DNA Replication Topoisomerase LAstand Primase E strand D Match the diagram with the correct term listed below. Structures Letter Okazaki fragments DNA polymerase RNA primer Helicase Leading strand Lagging strand 3' 5'
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
A replication fork is shown below. The primary enzyme that catalyzes replication is [ Select ] . That enzyme also [ Select ] The leading strand would be the [ Select ] . Helicase is a(n) [ Select ] In this picture, helicase would be moving in the [ Select ] direction. 3' > >
Examine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.
If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.