A Meselson-Stahl-experiment was performed to study the DNA replication of a newly discovered bacterium. This bacterium takes 30 min to complete a round of replication at 37° C. Figure 2.1 shows the autoradiography of the replicating DNA molecule. B A C D Figure 2.1 (i) Describe the steps of the Meselson-Stahl-experiment.
Q: 5. If enzymes are truly specific, they will catalyze the reaction of one substrate only. Predict whe...
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer ...
Q: To which class does each enzyme belong? Explain hexokinase alanine aminotransferase alcohol deh...
A: The enzymes are divided into 7 classes mainly oxidoreductases, transferases, hydrolases, ligases, ly...
Q: Describe the way a polypeptide is synthesized during translation.
A: Polypeptide refers to sequence of amino acids bonded to each other via peptide bonds. The synthesis ...
Q: What are the identities and functions of the components of the Bradford reagent in protein content d...
A: The Bradford method is a standard method used for determining concentrations of proteins in solution...
Q: What are the main structural features of the polysaccharides cellulose? How do this aid in its funct...
A: Carbohydrates are classified into three types on the basis of the number of sugar units they contain...
Q: In order to optimize acetylcholinesterase inhibition, a set of benzylamine derivatives were studied,...
A: The given relationship [log(1/C) = -0.187π + 0.57σ + 3.893] represent Hansch QSAR analysis model. QS...
Q: The image below is an example of the results that you could expect to see from your gel. Each group ...
A: PCR amplification of a gene and detecting the amplified product on agarose gel is very common practi...
Q: In man, there is gradation in eye color and resulting to 9 phenotypes. These are (in order of the nu...
A: Dark brown eyed child and hazel eyed will be there in the progeny. Hazel eye color is most likely to...
Q: Which of the following statements best describes the role of the enteric coating on aspirin tablets,...
A: Aspirin, also known as acetylsalicylic acid, is a drug that can be used to relieve pain, minor aches...
Q: Exercises: Directions: Complete the following lines for frame shift mutations. Write each codon on t...
A: Insertion mutation involves addition of genetic material in the form of nitrogen base to the reading...
Q: Vitamin C is found naturally in a number of fruits, particularly citrus fruits. It is also an organi...
A: The other name for Vitamin C is ascorbic acid or ascorbate. In humans, Vitamin C cannot be synthesiz...
Q: 7. RNA molecule cannot have secondary structure. DNA double-stranded form is maintained by hydrogen ...
A: The DNA and RNA molecular structures have particular conformation and bonding. Both the structures a...
Q: Write the structure of the Monosaccharide (Aldoses Family and Ketoses family)
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the glycosid...
Q: Topic: Determination of Protein Concentration by Spectrophotometry: The Standard Curve The use o...
A: Beer lamberts law is the basis of spectrophotometry. The principle of spectroscopy is based on the a...
Q: 1. Draw the tetrapeptide Met-Ala-Thr-Thr at a ph of 7? 2. Draw the tetrapeptide Met-Ala-Thr-Thr at...
A: The pKa values of amino acid side chains determines the pH-dependent net charge of an amino acid in ...
Q: Briefly describe 5 major types of lipids.
A: Lipids are macromolecules that are made up of fattyacids and glycerol. The composition varies depend...
Q: Prepare 100ml of TBST using 10% Tween 20 and 10x PBS (Final 1x PBS and 0.05% Tween 20). Could you pl...
A: TBST in the question stand for Tris-Buffer-Saline buffer supplemented with Tween 20. However, in que...
Q: The diploid chromosome number for the body cells of afrog is 26. What would that number be after thr...
A: Meiosis begins with a diploid cell and results in the formation of four genetically distinct haploid...
Q: Use the Stokes-Einstein equation to estimate the diffusion coefficient in m2/s and in um?/s for the ...
A: The Stoke-Einstein equation is used for calculating the diffusion coefficient of the spherical molec...
Q: What general transcription factors associate with an RNA polymerase II promoter in addition to the p...
A: Transcription is the process of synthesis of mRNA from DNA. RNA polymerase is the enzyme which carry...
Q: Determine which of the standard amino acids have a side chain with the following characteristics. C...
A:
Q: As the amount of substrate is increased in an enzyme-substrate reaction, which of the following will...
A: The enzymes are the biological catalysts, which increase the rate of a chemical reaction. The factor...
Q: Explain the consequence of the following structures.
A: The given structure represents the phospholipid molecules in a lipid bilayer. Phospholipids are comp...
Q: Briefly describe the relationship between degree of unsaturation and the physical characteristics of...
A: Lipids are biomolecules are made up of fatty acids and a glycerol molecule, which are joined to each...
Q: Draw the structure of alanylglutamylglycyllysine.
A: Peptides are nothing but small condensation products derived from amino acids. They appear small whe...
Q: Which of these are soluble in water, vitamin C or vitamin K? Explain your answer.
A: Carbohydrates, lipids, and proteins are macronutrients that the body requires in greater quantities ...
Q: based your analysis. Case study: Kale has been a smoker for a long time and has a terrible diet. He...
A: Introduction: Vitamin C is a water-soluble vitamin and it is also referred to as ascorbic acid. Hum...
Q: 1. How is the cell membrane similar to a plastic bag with tiny holes? 2. What two components make up...
A: Since there are multiple questions asked, we will solve only the first three questions. If you need ...
Q: Assume you have a solution of reactions with an enzyme. You decided to apply heat to further “increa...
A: All enzymes are made up of proteins. However, not all proteins function as enzymes. Enzymes are bioc...
Q: Calculate the enzyme and specific activity of a reaction with 3 μM Hsp90 using the following inform...
A: Given Values: The molecular weight of the Hsp90 = 82.7 kDa Concentration of Hsp90 = 3 μM Molar Extin...
Q: Are all the proteins separated properly using two-dimensional (2D) gel electrophoresis? Why or why n...
A: Two dimensional gel electrophoresis is an analytical technique that uses two techniques i.e. isoelec...
Q: During cell couting, when the data are plotted in an ordinary graph or on a cross-section paper, why...
A: For experiments involving growth of cells whether bacterial or eukaryotic the results of a growth ex...
Q: In noncompetitive inhibition, can both the substrate and the inhibitor bind at the same time? I kn...
A: Inhibitors are substances which bind to the enzyme and slow down or inhibit the enzyme activity. Bas...
Q: Why are buffers important in biochemical experiments? Please explainw ell
A: Buffer : solution which resists any change in pH via the addition of any acidic/ the basic component...
Q: Even under isotonic conditions, there is a slow leakage of ions into animal cells. How does the plas...
A: Osmosis is biochemical process by which water moves from a less concentrated solution to more concen...
Q: 1. Maltose is a disaccharide of, Explain in 2-3 sentences why you chose this answer. A. glucose and ...
A: Disaccharides are formed when two monosaccharides are joined together and a molecule of water is rem...
Q: The following structures were introduced as neuromuscular blocking agents. Structure B is derived fr...
A: Here compound A and B both are choline derivative as both have Choline group at both end in the stru...
Q: Explain the effect of anti acids (example MaAlOx) to the enzyme in the enzyme. How does it affect di...
A: The digestive system is one of the body’s important systems that break down the complex components o...
Q: Explain the importance of adding TE Buffer as the final solution to isolate the concentrated DNA.
A: DNA isolation is a process of extracting nuclear material from a tissue sample. The tissue sample is...
Q: Using a pipette, add 2 mL of suspended DEAE SEPHAROSE (anion) resin to a chromatographic column. Rep...
A: DEAE Sepharose matrix is used in Anion exchange column. In the given method power of salt strength i...
Q: In the first step of the citric acid cycle, an acetyl group from acetyl CoA reacts with oxaloacetate...
A: Citric acid cycle is one of the steps in aerobic oxidation of glucose. It occurs in mitochondrial ma...
Q: . Glycosidic bond between galactose and glucose in lactose is ______. In 2-3 sentences, explain why ...
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the glyco...
Q: Based on the given results, what do you think is the isoelectric pH of casein? Briefly discuss your ...
A: Casein is a key protein of milk and present in large amounts in cheese. Proteins are polymers of ami...
Q: 3. What is the name of the molecule in the circled region labelled M (be specific)? How do you know?...
A: The backbone of a nucleic acid is made up of a sugar-phosphate chain linked by phosphodiester linka...
Q: Sulfanilamide, a sulfur drug, acts as an antibiotic. Explain its mechanism of action in the context ...
A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...
Q: Respiratory paralysis. Tabun and sarin have been used as chemical-warfare agents, and parathion has ...
A: Biological warfare, often known as germ warfare, is the intentional deployment of biological toxins ...
Q: 9. The transamination of the amino acid aspartate is catalyzed by aspartate aminotransferase. A) Dr...
A: A)TRANSAMINATION is the process by which amino groups are removed from amino acids and transferred t...
Q: suggest two reactions that are very fast (are over in minutes or seconds)?
A: A chemical change is called a chemical reaction. It requires varying lengths of time for completion....
Q: Hair is made of protein. The protein is a structural protein called α-keratin, which contains many d...
A: Amino acids are organic molecules having an amino group and an acid group. Amin...
Q: Find the Gibbs free energy of mixing when 2 moles of ethanol is mixed with 5 moles of water at a tem...
A: Given; n1= no. of moles of ethanol= 2 mol n2= no. of moles of ethanol= 5 mol T=27oC =273+27=300K ...
Trending now
This is a popular solution!
Step by step
Solved in 5 steps with 1 images
- There are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).A Meselson-Stahl-experiment was performed to study the DNA replication of a newly discovered bacterium. This bacterium takes 30 min to complete a round of replication at 37° C. Figure 2.1 shows the autoradiography of the replicating DNA molecule. B A C D Figure 2.1 (i) Describe the result of this experiment.A Meselson-Stahl-experiment was performed to study the DNA replication of a newly discovered bacterium. This bacterium takes 30 min to complete a round of replication at 37° C. Figure 2.1 shows the autoradiography of the replicating DNA molecule. В A C D Figure 2.1 (i) Draw a DNA replication diagram to explain your observation.
- Using bacteriophage P22, you performed a threefactor cross in Salmonella typhimurium. The crosswas between an Arg− Leu− His− recipient bacteriumand bacteriophage P22, which was grown on an Arg+Leu+ and His+ strain. You selected for 1000 Arg+transductants and tested them on several selective media by replica plating. You obtained the followingresults:Arg+ Leu− His− 585Arg+ Leu− His+ 300Arg+ Leu+ His+ 114Arg+ Leu+ His− 1a. What are the cotransduction frequencies of argwith either his or leu?b. Is arg closer to his than it is to leu, or is arg closerto leu than it is to his? What are the relative mapdistances?c. Why can you not obtain an accurate cotransductionfrequency for his and leu from the data provided?d. What is the order of the three markers?e. Draw the crossovers that would produce the classwith only one transductant.f. Estimate the proportion of the 4.9 Mb S. typhimuriumgenome that contains these three genes. Assume thatbacteriophage P22 can package the same amountof DNA as the…A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide LengthThe Escherichia coli chromosome is a circular DNA molecule and contains a single origin of replication. List the mechanistic steps that can terminate the movement of replication forks in this chromosome.
- Consider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in cultures of E. coli and equilibrium density gradient centrifugation. Draw pictures to represent the bands produced by bacterial DNA in the centrifuge tube before the switch to medium containing 14N and after one, two, and three rounds of replication in that medium. Use separate sets of drawings to show the bands that would appear if replication were (a) semiconservative; (b) conservative; (c) dispersive.For each of the following ( A & B ) provide the method of transfer and a brief explanation as to why the method would not take place under the conditions described . 1. Which method of DNA transfer between bacteria would not take place if the donor and recipient were separated by a filter with a pore size of 0.45 um or another physical barrier 2. Which method of transfer would be blocked by the presence of high concentrations of DNAase ( enzymes capable of degrading DNA ) ?This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.
- Norflaxacin is a cidal broad spectrum antibiotic that functions by inhibiting DNA gyrase in gram +/- cells. (DNA gyrase reverses supercoiling which occurs when DNA is unwound during replication). Why does Norflaxacin harm infecting bacteria but not human cells?Acridine orange is a chemical that inhibits the replication ofF- factor DNA but does not affect the replication of chromosomalDNA, even if the chromosomal DNA contains an Hfr. Let’s supposethat you have an E. coli strain that is unable to metabolizelactose and has an F factor that carries a streptomycin-resistantgene. You also have an F− strain of E. coli that is sensitive to streptomycinand has the genes that allow the bacterium to metabolize lactose. This second strain can grow on a lactose-containing medium.How would you generate an Hfr strain that is resistant tostreptomycin and can metabolize lactose? (Hint: F factors occasionally integrate into the chromosome to become Hfr strains, and occasionally Hfr strains excise their DNA from the chromosome to become F+ strains that carry an F′ factor.)If you extract the DNA of the coliphage φ X174, you willfind that its composition is 25 percent A, 33 percent T,24 percent G, and 18 percent C. Does this compositionmake sense in regard to Chargaff’s rules? How wouldyou interpret this result? How might such a phage replicate its DNA