Q: the following processes except a. alternative splicing to produce a secreted form of the T-...
A: Answer 1st answer - d) somatic recombination 2nd answer - d) CTLA4, SUPPRESSION
Q: Photosynthesis can be divided into multiple stages. What are the stages of photosynthesis, and where...
A: Photosynthesis refers to the biochemical process that occurs in the chloroplasts of plants to conver...
Q: Hand drawing of a forest ecosystem foodchain
A: Introduction: A food chain is a linear sequence if organisms representing producer to top consumer o...
Q: what is the role of (1) electrochemical gradient created by ions, (2) permeability of the membrane p...
A: There are a lot of ions present inside and outside the cell. From time to time these ions adjust th...
Q: Dr. Robinson loves to cross-country skit After a 2 hour ski, there is an increase in epinephrine lev...
A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...
Q: Match the terms with the most suitable description. ___ operon a. makes a man ou...
A: The options are matched with the suitable description and they are given below
Q: similarities and differences between malaria and covid 19
A: An infection is the invasion of an organism's body tissues by disease-causing agents, their multipli...
Q: A collection of similar phyla or divisions * a. family b. order c. kingdom d...
A: 1. A collection of similar phyla or divisions- c. Kingdom Kingdom: In biology, a kingdom is the se...
Q: Calculate the viral titer of an experiment performed yielding a pfu of 279 from plating 1.0 ml of th...
A: To determine viral infectivity, common practice is to perform a viral titration to infect the host c...
Q: ADH1A alcohol dehydrogenase 1A (class I) Describe a way in which the gene can be manipulated to trea...
A: * The gene ADH1A alcohol dehydrogenase gene encodes a member of the alcohol dehydrogenase family. a...
Q: How can people effectively manage stress when diagnosed with cardiovascular conditions?
A: When people diagnosed cardiovascular conditions than how can manage stress
Q: Which of the following are differences between prokaryotic DNA replication and eukaryotic DNA replic...
A: Replication is the process of producing two daughter identical copies of DNA from one original paren...
Q: Discuss and explain deamination and repair
A: Repair of deamination product is done by base exision repair. Enzymes like DNA glycosylase, AP Indon...
Q: QUESTION 13 Normal (non-cancer) cells grewing in eulture DA Can be maietained infinitely (e are imme...
A: Plasma membrane is the outermost covering of all the living cells. Cancer is defined as uncontrolled...
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand. ...
A: The template strand is a DNA strand that functions as a template for the synthesis of complementary ...
Q: Sdve this response. Question 1 Which of the following can cause evolution? Select all that apply. OA...
A: Evolution is change in characteristics of a species over successive generations. The idea of evoluti...
Q: Which is a characteristic of pseudoscience or bad science? a) Considers evidence for and against a h...
A: Pseudoscience comprises explanations, beliefs, or practices that case to be both logical and authent...
Q: A group of closely related strains, not all identical * a. class b. specie c. no...
A: Strains are genetic variants, subtypes or culture within a biological species. Class is the group of...
Q: veterinary science
A: Answer :: In veterinary science, the three examples of mother nature's ID methods. Personification o...
Q: The inner mitochondrial membrane exhibits all of the fundamental characteristics of a typical cell m...
A: Some unique characteristics of a typical cell membrane include: Presence of cristae. Restricted amo...
Q: 1.) Propose the biosynthesis of 5-methylorsellinic acid: CH; НО CH3 `CO,H OH
A: 5- methylorsellinic acid is a dihydroxybenzoic acid. That is O-orsellinic acid in which the hydrogen...
Q: Which of the following statements related to classifications of rarity and extinction is TRUE? A spe...
A: * the factors for extinction are diseases. predators. competitors. climate change. catastrophic ...
Q: What are the differences of dogs from other kingdoms?
A: Identification : Whittaker proposes 5 kingdom classification based upon cell structure, organizati...
Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...
A: The correct option is C.
Q: If the pressure in the ventricles is higher than the pressure in the atria, but lower than the press...
A: Heart valves open and close in response to pressure changes inside the heart chambers. the fluid und...
Q: Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation...
A: Agarose gel concentration More the concentration of the agarose gel more smaller will be its pores....
Q: Which of the following scientific names is not correctly formatted? a)Helicobacter Pylori b)All of ...
A: ANSWER correct answer = Gorilla gorilla Kingdom: Animalia Phylum: Chordata Class: Mammalia ...
Q: Does changing the sequence of nucleotides always result in a different amino acid sequence? Explain
A: No, changing the sequence of nucleotides does not always result in a different amino acid sequence.
Q: Andalusian chickens may be either black, white, or gray. The gene for black is not dominant over th...
A: Note- we are supposed to answer 1 question with three subparts according to our guidelines. Please r...
Q: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne...
A: Permutation infers the maximum number of possible arrangements by given things/ variables that can b...
Q: Simian Virus 40 is carcinogenic in primates. 1). which molecule of the virus 2). what particular ...
A: Viruses come under the category of microorganisms (tiny creatures) that can be found in the environm...
Q: The eukaryotic cell at left is in the processof cytoplasmic division. Is this cell from aplant or an...
A: Cytoplasmic division is otherwise called as Cytokinesis which separates the original cell, its orga...
Q: Which reaction normally happens in the regulation of the trp operon when high levels of tryptophan a...
A: The trp repressor controls the trp operon. When coupled to tryptophan, the trp repressor prevents th...
Q: What would have happened if the darwinian revolution did not unfold?
A: Darwin revolution is revolution after his book origin of species.
Q: How many N-terminus are there in this cartoon?
A: *There are four types of protein structure are present. primary structure secondary structure terti...
Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a tex...
A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are cal...
Q: List the main events that occur during each stage of mitosis.
A: Introduction: The process of cell division that results in the formation of two new daughter cells i...
Q: Referring to the genetic code (the codon usage table), what would be the amino acid sequence of the ...
A: Mutations are a sudden, heritable change in the DNA sequence that alters the amino acid sequence whi...
Q: The "principle of tolerance limits".. O relates species abundance and distribution to the physiologi...
A: * principle of tolerance developed by American zoologist victor Ernest shelford. * It states that t...
Q: The part of a fungus that grows in its food source (often underground) is a body called its ___? mad...
A: Fungi are the heterotrophic organisms which shows great diverdity in morphology and habitat. most co...
Q: The achoo syndrome (sneezing in response to bright light) and trembling chin (triggered by anxiety) ...
A: Since human cells Carry 2 sets of chromosomes having same set of genes. So these 2 version of genes...
Q: 3. Red-green color blindness (b) is a recessive sex-linked trait. A colorblind male marries a normal...
A: * Red-green color blindness is also called as deuteranopia. * The affected individuals having this t...
Q: True or False: if an organism is multicellular, you can be certain that it is not a bacterium.
A: Multicellular: These are the organisms which consists of more than one cell Examples include human ...
Q: Cytoplasm of a plant cell divides by the process of_____ . a. telekinesis c. fission b. nuclear divi...
A: Introduction Cytoplasm is a viscous liquid that fills each cell and is surrounded by the cell membra...
Q: Maximal production of ATP from glucose involves the reactions of glycolysis, the citric acid cycle, ...
A: Cellular respiration is the process by which organisms utilize oxygen to break down complex food mol...
Q: Where is the sucrose produced by photosynthesis generated?
A: Photosynthesis includes light-dependent and light-independent phases.
Q: 1. Let's imagine what would happen to the amount of DNA material in a cell if, when it reproduced, i...
A: * During mitosis there are the following phases G1 phase S phase G2 phase M phase * During G1 pha...
Q: 10. A student group decides to conduct an experiment testing the germination rate of radish seeds so...
A: Calculating results To calculate germination percent, divide the wide variety of healthful seedlings...
Q: Diagram 2: Canine Eye Put the name of 1.Gland 2.Conjunctiva tear 6. retina 7. Nasal tear duct 3. Len...
A: * pupil of eye is the black circle in the shape placed in center of the iris. *The iris is colored ...
Q: Control over eukaryotic gene expression drives______ . a. transcription factors c. embryonic develop...
A: In eukaryotes, gene expression is influenced by a wide range of mechanisms such as loss of genes, am...
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Lamivudine (3TC) An analogue of deoxycytosine, a DNA component Needs to be first phosphorylated by cellular deoxycytosine kinase Indicated for HIV (both -1 and -2), and Hepatitis B (a DNA retrovirus, Baltimore Class VII) Toxicity for uninfected cells How does 3TC inhibit Hepatitis B?Question 4 Which of the following represents an example of a proteoglycan? attachment of several molecules of heparin to the peptide antithrombin II attachment of a Gal-B(1,3)-GalNAc disaccharide to the fish antifreeze protein attachment of a small oligosaccharide to an immunoglobulin O attachment of a small antigenic determinant to a membrane bound protein of a cellThe healthy CFTR protein functions in transporting Cl- ions across the lipid bilayer of the cell plasma membrane. 13b.What drives the movement of Cl- ions across the lipid bilayer in this example.
- Pathogenic E. coil have recently been shown to degrade tight junction proteins during infection. How would this provide an advantage to the bacteria?Cytokine Storm (Cytokine Storm) COVID-19The high mortality rate in COVID-19 patients is caused by the occurrence of a cytokine storm (cytokine storm) in the patient's body. This is based on research supported by data obtained, among others, from laboratory results; that there was a significant difference between patients who recovered and those who died. What research data? Please Answer these following structured questions; Are cytokines a protein? How many amino acid residues of human cytokines? The sequence of the amino acid residues? Accession number at GenBank ? Determine the mRNA sequence Determine the coding sequence Define the sequence template What is a Cytokine storm What research data support the occurrence of Cytokine storm in humans Answers on paper with source cited provided will be helpful since im new in this part and want to learn from the source you find the answer Thank youQuestion one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -
- macrophages Question 48 Please describe/name the structural variants describe in the picture: Courtesy of CRC Press/Taylor & Francis Group А. 1 ACGCTGCGGTTCGATAGT 2 ACGCTGCG-TTCGATAGT В. 1 ACGCTGCGGTT-CGATAGT ACGCTGCGGTTTCGATAGT C. 1 ACGCTGCGGTTCGATAGT ACGCTGC CA GATAGT D. 1 CACACACACACACACACACACACA 2 CACACACACACACACACACACA E. 1 100 100 | 100 100 2 100 100 100Ras is a kinase enzyme that can attach a phosphate group to MAPKKK during signal transduction In a cell. Ras has a lipld anchor covalently attached to It. MAPKKK Is an example of a Onucleoprotein O lipoproteln O metalloproteln O phosphoprotein O glycoproteln O hemoprotein Submit Answer Retry Entire GroupQUESTION 1 An enzyme-linked immunosorbent assay requires A. a radioactive substrate. B. a radioactive standard. OC. an antibody that binds the protein of interest. D. aromatic amino acids E. a denaturant.
- answer all the three given sub questions. If not, will give thumbs down I. TRUE OR FALSE1. A mutation is considered induced when a bacterial cell is exposed to harsh environmental conditions and developed a resistance mechanism against beta-lactams 2. One example of a bacterial phenotypic expression is Gram's reaction 3. Which of the following phases in the bacterial growth curve indicates depletion of available nutrients leading to the accumulation of metabolic waste leading to cell deathThe distal histidine stabilises the iron in heme group of a deoxyhaemoglobin. T/FOne of the more common adverse effects of cancer chemotherapy is the destruction of leukocytes. Before his next scheduled chemotherapy treatment, a patient undergoes a blood test called an absolute neutrophil count (ANC), which reveals that his neutrophil count is 1900 cells per microliter. Would his healthcare team be likely to proceed with his chemotherapy treatment? Why?