4.) what is the amino acid chain that your answer in item 2 will dictate? Question in Item 2: The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? Answer : The mRNA complementary strand from this complementary strand obtained from item 1 should be:AAGUUUCGCCCCGGG. 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1. Question in item 1 : if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? Answer : According to complementary base pairing rules, A is complementary to T and G is complementary to C. Hence the complementary DNA strand should be:TTCAAAGCGGGGCCC

Q: What is the direction of RNA synthesis? Is it the same as DNA replication?  How does RNA…

A: Asked : Direction of RNA synthesis,DNA replication and RNA transcription end process

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this,…

A: The central dogma of molecular biology tells us how protein is made from a DNA sequence. This…

Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)

A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: 1.) if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its…

A: (Note: According to guidelines, we are supposed to answer only three subparts. Please repost other…

Q: Given the following stretch of mRNA, what would be the sequence of the corresponding non-template…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of cell.

Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: 1. If the gene above is transcribed into a functional mRNA,  a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: A CODING STRAND of DNA has the sequence 5' ATGCCG 3' what would the resultant mRNA transcript…

A: Coding strand is the strand which contain the sequence that are identical to the mRNA transcript…

Q: 1. What is the complementary strand of sequenced DNA? 2. What is the transcription product of this…

A: Here, template stand is given having direction 3'→5' new complementary strand synthesized in 5'→3'…

Q: The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process? 2. What…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: According to Bartleby guidelines only the first question in case of multiple questions have to be…

Q: elow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: DNA and RNA are the genetic material which have the genetic information about perticular organism…

Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……

A: DNA is composed of different nucleotides that consist of genetic information in genes. If two copies…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…

A: Gene expression is the process by which the instructions in the DNA is converted into a functional…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: The RNA is produced from the template strand of DNA by the transcription process that occurs within…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…

A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…

Q: Which of the following statements below is incorrect? *   A. the genetic code is overlapping   B.…

A: As per guidelines, you have asked multiple questions we will solve the first question for you. If…

Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…

A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…

Q: Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each…

A: Dr. Francis Crick gave the central dogma of molecular biology which states that the information…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: 4. A double-stranded DNA molecule with the sequence shown below produces, in vivo, a polypeptide…

A: Transcription is the DNA dependent RNA synthesis. Process of transcription is catalyzed by RNA…

Q: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming…

A: Hello! According to guidelines we have to answer the first 3 sub-parts only. so please kingly post…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…

A: The process of copying the information in a strand of DNA to produce an mRNA is called…

Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: 8.) Answer the following questions regarding the following DNA sequence.…

A: During transcription RNA synthesis occurs over DNA and translation or protein synthesis occurs over…

Q: 1) List 5 factors involved in the process of either initation or elongation of translation

A: Translation is the process by which the genetic code contained within an mRNA is decoded to produce…

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: DNA has two strands. One of the strands acts as the template strand for the synthesis of mRNA, while…

Q: Which of the following statements are NOT true?   A. Replication is the process of making DNA and…

A: During protein synthesis, translation is the method of transforming the sequence of a messenger RNA…

Q: 1. Why is the specific base pairing is essential to the processes of transcription and translation?…

A: Introduction Translation:- It is the process in which a cell makes proteins using the genetic…

Q: During DNA replication a mutation occurs that reuskt in the following chnage in the corresponding…

A: It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins…

Q: Part A) In your own words describe what happens in transcription and translation Include which…

A: DNA(Deoxyribonucleic acid) is defined as type of double helical molecule  composed of two…

Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…

A: The information from the DNA is transferred to RNA by transcription. The information present in the…

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…

A: DNA strand given here with directionality is as: 5’…

Q: 5'--TTAATGGGACAGCTTGTGTAGAGG--3' a.) What is the complementary strand of DNA? b.) What is the…

A: A nucleotide is the basic building block of nucleic acids. Ribonucleic acid and Deoxyribonucleic…

Q: 4. Draw and label the Transcription process. 5. Draw and label the Translation process.

A: Transcription is the process in which RNA is made from DNA, while  translation is the process in…

Q: 2 3 3' 5' ATGACGGATC UACUGCCUAGUC 5 SCAAGCGGAATTGGCGACATAA GCGUU 3…

A: Genetic information is transferred from DNA to the proteins via RNA by the process of transcription…

Q: 1.) if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its…

A: Introduction DNA, or deoxyribonucleic acid, is an unique molecule that includes all of the…

Q: Transcribe the corresponding mRNA strand from the given DNA strand:    DNA:     TAC       GCA…

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid.  It is the genetic material of all…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.