Homework Help is Here – Start Your Trial Now!
Science
Biochemistry
3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer? (B) Considering the ordering of the monomers, what is this type of polymer called? (C) We can use a sequencing machine to artificially construct any DNA sequence we want, such as this: AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAA What type of polymer would this be? (D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You find that when you measure the mechanical properties along one direction of the crystal it has a different response than along the opposite direction. What do you call a material when the measured properties are different along different crystal directions? (E) You melt the DNA crystal by raising the temperature and let the crystal reform at a higher temperature than you formed the initial crystal. This new crystal has a different structure. What is this called when a material that has been processed differently has different structures? What does the fact that the different structures preferentially form at different temperatures indicate? (F) You can engineer beams of DNA (see below) and construct structural elements, where the beams are "pre-stressed", or constructed with built in stresses. What kind of stresses do the beams experience if they have forces acting perpendicular to their cross-sectional area? (G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams, what mechanical stress would the construct experience?

3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer? (B) Considering the ordering of the monomers, what is this type of polymer called? (C) We can use a sequencing machine to artificially construct any DNA sequence we want, such as this: AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAA What type of polymer would this be? (D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You find that when you measure the mechanical properties along one direction of the crystal it has a different response than along the opposite direction. What do you call a material when the measured properties are different along different crystal directions? (E) You melt the DNA crystal by raising the temperature and let the crystal reform at a higher temperature than you formed the initial crystal. This new crystal has a different structure. What is this called when a material that has been processed differently has different structures? What does the fact that the different structures preferentially form at different temperatures indicate? (F) You can engineer beams of DNA (see below) and construct structural elements, where the beams are "pre-stressed", or constructed with built in stresses. What kind of stresses do the beams experience if they have forces acting perpendicular to their cross-sectional area? (G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams, what mechanical stress would the construct experience?

Biology: The Dynamic Science (MindTap Course List)
Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Chapter3: Biological Molecules: The Carbon Compounds Of Life
Section3.5: Nucleotides And Nucleic Acids
Problem 1SB: What is the monomer of a nucleic acid macromolecule?
See similar textbooks
icon
Related questions
Question

Please answer all question parts. please make sure to answers the questions  (numbered corresponding to the questions and question parts)

Thank you

3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer? (B) Considering the ordering of the monomers, what is this type of polymer called? (C) We can use a sequencing machine to artificially construct any DNA sequence we want, such as this: AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAA What type of polymer would this be? (D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You find that when you measure the mechanical properties along one direction of the crystal it has a different response than along the opposite direction. What do you call a material when the measured properties are different along different crystal directions? (E) You melt the DNA crystal by raising the temperature and let the crystal reform at a higher temperature than you formed the initial crystal. This new crystal has a different structure. What is this called when a material that has been processed differently has different structures? What does the fact that the different structures preferentially form at different temperatures indicate? (F) You can engineer beams of DNA (see below) and construct structural elements, where the beams are "pre-stressed", or constructed with built in stresses. What kind of stresses do the beams experience if they have forces acting perpendicular to their cross-sectional area? (G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams, what mechanical stress would the construct experience?
Transcribed Image Text:3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer? (B) Considering the ordering of the monomers, what is this type of polymer called? (C) We can use a sequencing machine to artificially construct any DNA sequence we want, such as this: AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAA What type of polymer would this be? (D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You find that when you measure the mechanical properties along one direction of the crystal it has a different response than along the opposite direction. What do you call a material when the measured properties are different along different crystal directions? (E) You melt the DNA crystal by raising the temperature and let the crystal reform at a higher temperature than you formed the initial crystal. This new crystal has a different structure. What is this called when a material that has been processed differently has different structures? What does the fact that the different structures preferentially form at different temperatures indicate? (F) You can engineer beams of DNA (see below) and construct structural elements, where the beams are "pre-stressed", or constructed with built in stresses. What kind of stresses do the beams experience if they have forces acting perpendicular to their cross-sectional area? (G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams, what mechanical stress would the construct experience?
(H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure, and it increases in dimension in the perpendicular direction, what do you know about the Poisson's ratio of this material? Explain how the behavior compares with a typical material.
Transcribed Image Text:(H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure, and it increases in dimension in the perpendicular direction, what do you know about the Poisson's ratio of this material? Explain how the behavior compares with a typical material.
Expert Solution
steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Medical terminologies
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning
SEE MORE TEXTBOOKS