Q: Multiple choice: DNA replication is _____. CHOOSE ONE ONLY: A.) Is part of interphase B.) Occurs…
A: INTRODUCTION DNA replication Process by which genome's DNA copied in the cell.
Q: What components are important for making a lipid membrane? please explain the answer and choice the…
A: Cell membrane/ plasma membrane is the curtain that separates the interior portion of cell from the…
Q: Chloroplastic ATP does not leave the chloroplast; chloroplastic ATP fuels the fixation of Carbon in…
A:
Q: Which is not a common symptom of diabetes
A: The pancreas is a mixed gland. It consists of endocrine and exocrine parts. The endocrine part…
Q: Which among these can the expression of the gene of interest be increased via (multiple choice,…
A: When a particular segment of DNA or a gene is transcribed into RNA then it is known as gene…
Q: How many premolars in the dental formula for prosimians and New World Monkeys (NWMs)?
A: Primate dentition reveals information about the foods monkeys consume. The dental formula is one of…
Q: Use the graph below to answer the following questions: Free Energy A+B a. I 1 b. Progress of the…
A: The lowest amount of energy needed to activate atoms or molecules so they can undergo chemical…
Q: It might be easier to catch a snake in the early morning, compared to night. Why?
A: Snakes belong to the class reptilia of the animal kingdom. These animals crawl and most reptiles…
Q: List five (5) factors affecting fixation of the cells in a physical and chemical state
A: Fixation: Fixation is a procedure in which cells or tissue are fixed partially in a chemical and…
Q: Match the following Existence of a deity Formation of protobionts Organic molecules originating from…
A: The earth atmosphere was different from the present atmospheric conditions. The life pattern is also…
Q: n vitro fertilization (IVF) is a common assistive reproductive technology for couples who are…
A: c reptiles
Q: One form of posttranscriptional modification of most eukaryotic pre-mRNAs is the addition of a…
A: Introduction:- Transcription is the synthesis of RNA molecules. After the completion of…
Q: (a) Explain the signals (wingless, Hh, Serrate) how they are sent and received (b) what is the…
A: Introduction. Segmentation in drosophila is a spatially and temporally regulated sequential event.…
Q: of the gene of interest be increased via (multiple choice, choose one) A. PCR B. bacterial vectors…
A: Gene expression is a process in which a particular gene forms a protein. It involves transcription…
Q: Choose all of the statements that describe the benefits of combinatorial control of transcription in…
A: Combinatorial gene regulation is a mechanism in which small numbers of transcription factors will…
Q: Explain why gazelles display goiter:
A: Medium-sized, light-built animals and goitered gazelles have a more robust body form. The name…
Q: it possible to perform aerobic fermentation using yeast? Explain why and compare the fermentation
A: Introduction:- The Fermentation that has to occurs in yeast cells and the bacteria and also in the…
Q: Which of the following monomers is correctly matched with its polymer? Fatty acid-protein…
A: Introduction :- Monomers are atoms or tiny molecules that combine to form polymers, which are more…
Q: A bacterial strain is killed by tetracycline. We would say that this strain is to tetracycline. Take…
A: Antibiotics are used to treat pathogenic infections, mainly caused by bacteria. The antibiotics…
Q: Which of the following is involved in recombinant DNA technology? Explain. MULTIPLE CHOICE.…
A: The technology which creates a transgenic product is called recombinant DNA technology. In this…
Q: Gluconeogensis uses nearly all of the same enzymes as those in ____, and is a(an) ______ reaction.…
A: The oxygen is required in the aerobic respiration to produce energy in the form of ATP. This aerobic…
Q: Illustrate the chromosome changes in interphase and mitosis using a diploid cell that is 2n=4 (two…
A: Mitosis is a type of cell division in which one mother cell divides to produce two new daughter…
Q: describe the molecular switches involved in microbial acute/prolonged starvation response. give one…
A: Microbes adopt a number of strategies during the starvation/stationary period. All these strategies…
Q: Determine the number of molecules created from B-Oxidation: FADH2, NADH + H, Acetyl-CoA,…
A: Each beta oxidation cycles yields 1FADH2 , 1NADH and 1 acytyl- Co A. Which in turn is equivalent to…
Q: What is the only genetically modified meat available to purchase? You can purchase a variety of…
A: Genetically Modified Organism: Any creature whose genetic makeup has been changed through genetic…
Q: detail explain the experiment that helped Hershey and Chase recognize DNA as a genetic
A: Ans: Harshey and Chase studied bacteriophage, a virus that attacks bacteria. The phage samples were…
Q: How will the function of skeletal muscle tissue in your hands be affected over time when used…
A: Muscles are the body's greatest protein storage facility. Whenever dietary protein is scarce, the…
Q: The fact that synaptogenesis happens at different ages in different areas of the brain differs,…
A: Answer: It helps to explain why vocabulary development develops sooner than impulse control that…
Q: When the skin is exposed to sunlight it will produce: Calcium Vitamin D Vitamin C Vitamin D…
A: We know that The skin is the largest organ in the human body that forms a barrier by covering the…
Q: Not all of the DNA in an organism contains genes. Explain and relate in marker development to tag a…
A: Gene is a region of DNA which codes for a functional product which could be a mRNA or a specific…
Q: Match the technique that can potentially aid the reproductive problem Low sperm count Eggs not…
A: The fusion of male and female gametes (within the female reproductive system) is known as…
Q: Which of the following is not a tissue-resident macrophage? Kupffer cells circulating…
A: Please follow step 2 for detailed explanation.
Q: 9) The accompanying pedigree is for a rare, but relatively mild, hereditary disorder of the skin. 1…
A: Inheritance patterns describes about the distribution of genetic variants in families. The disease…
Q: Why is the 16S rRNA gene sequence used in identifying bacteria species
A: Introduction - 16S rRNA gene sequence analysis can better identify poorly described, rarely…
Q: How do you compute carboxylation capacity (Vcmax) and what does the value tell you about the plant?
A: Answer: The maximum Rubisco carboxylation capacity, or Vc,max, is a crucial photosynthetic metric…
Q: You Answered 1. If a negatively supercoiled (ALK = -32) closed circular DNA is relaxed by one…
A: Linking number (Lk)= total number of base/basepair per helical turn in its relaxed form…
Q: O Simple columnar glandular epithelium
A: Answer :- structural component of the stomach mucou membrane will be most ensuring its protection…
Q: Ⓒ→ [ooo 2 A UGG 3 сл G 1
A: Introduction :- The illustration is denoting the process of translation. After DNA is converted to…
Q: Chlorophyll is the dominant pigment in photosynthetic cells, and degrades earlier than carotenoids…
A: Chlorophyll is the dominant pigment in photosynthetic cells. and degrades earlier than carotenoids…
Q: What are the effects of IL-10 on peripheral nerve terminals of nociceptor neurons. stimulatory…
A: The effect of IL 10 on Peripheral nerve terminals of nociceptor neurons is Inhibitory. Nociceptor…
Q: Draw liver cells through a microscope
A: Liver contain lipid droplets, which secrete extra cellular matrix proteins. *The activation of…
Q: Which of the following is FALSE? A. Most children first diagnosed with oppositional defiant…
A: Children with behavioral conditions are prone to impetuous, hyperactive, and violent behaviors. They…
Q: What happens in the cell eventually after signals are transduced?
A: Cells communicate with each other via released proteins unique to each kind. Cell signaling can be…
Q: Instr KXN302 Result 11.96 2.94 8.0 26.0 88.4 27.2 30.8 257 14.1 9.7 Test Code WBC RBC HGB HCT MCV…
A: The normal HGB or the hemoglobin range for a normal healthy person for Men - 13.2 -16.6 grams per…
Q: 8. Define "eusociality". Explain, in genetic terms, why eusociality is especially prevalent in ants.…
A: Eusociality can be defined as a living arrangement by a group of organisms (animals) in…
Q: 16. What is the membrane potential when the ratio of the ion concentration values is X-1) / X.
A: The resting membrane potential, also known as the resting potential, is a voltage across the…
Q: Are the following primates (same species) exhibiting sexual dimorphism? Explain your reasoning:
A: The characteristics of the organisms are the basis of their classification system. It also gives an…
Q: Before mitosis, a cell has 18 chromosomes. After mitosis, each cell has ____ chromosomes. 6 12 18 36
A: Cell cycle at the series of events that are responsible for producing the total cells from the…
Q: What problems does Digestion solve
A: Digestion is a physiological process in which complex food materials is broken down into simpler…
Q: Sexual reproduction increases variation True False
A: Sexual reproduction is the process of creating new creatures by uniting the genetic information of…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The figure below depicts various elements of the eukaryotic replication machinery in action. Enter the name for the protein depicted by each box. Box A Box B Box C Box D Box E Box F DNA polymerase on lagging strand (just finishing an Okazaki fragment) F Maintains polymerase association with DNA Enzyme extends separation of DNA strands Synthesizes RNA fragments that hybridize to DNA Relaxes supercoiled DNA ahead of replication fork Maintains DNA is single stranded state Promotes binding of processivity factors to DNA Newly synthesized strand pocoar Leading-strand template A New Okazaki fragment RNA primer E Lagging-strand template DNA polymerase on leading strand B C D Saaragon - Next Okazaki fragment will start here Parental DNA helixBelow is a picture of a single origin of replication in a eukaryotic cell. 5' 3' 5' 1. On the figure above, Draw out where the following molecules will be located: Helicase; Sliding Clamp, Single Strand Binding Protein. 2. On the right hand side of the dotted line, the replication of which template strand (top or bottom) will be continuous by DNA polymerase? 3. On the left hand side of the dotted line, the complete replication of which template strand (top or bottom) will be more affected by a mutation that causes DNA ligase to be partially functional?Name 4 proteins present at a replcation fork during DNA replication and tell what they do. For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS up Paragraph Arial 14px MacBook Pro 000. F2 F3 F4 F5 F6 F7 F8 %23 & !!! %24
- For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 12. Is the top or bottom the leading strand? 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand. 14. What enzyme copies the DNA by adding DNA nucleotides? 15. What enzyme links Okazaki fragments together on the lagging strand?Using the picture below, match each letter (A-E) to 5' or 3' DNA polymerase molecule Parental DNA Replication fork A [ [ Choose ] [ [ Choose ] [ [ Choose ] D [ [ Choose ] E [ [ Choose ] > > > > B.this is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever. the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.
- TRANSLATE this RNA sequence: AUGCAAUGA Met-Gln-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop What would happen if the nitrogen base second to the last of the sequence will undergo a point mutation, (G turning to A) Met-Gin-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop The DNA sequence ATCAGCGCTGGC is part of a gene. how many amino acids are coded for by this message? O 4 8. 12 20 Option 5 For the lab part: how is DNA used for catching crime suspects. Describe the procedure and cite a particular example where it helped solve a case or absolved an innocent person from any wrongdoing. Your answer O OFor the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand.Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5' O 5' GCG TCA CCT GTA AAG 3' O 5' GAA ATG TCC ACT GCG 3' O 5' GCG UCA CCU GUA AAG 3' O 5' GAA AUG UCC ACU GCG 3'
- Match the enzyme on the left with its role in DNA replication DNA polymerase I helicase DNA ligase DNA polymerase III topoisomerase primase 72 W w# 3 E $ 4 R % 5 T A 6 MacBook Pro Y & 7 U * 8 replaces primers with DNA connects Okazaki fragments to form a continuous strand of DNA synthesizes short RNA fragments used to initiate DNA synthesis Uses the 3'OH of an RNA primer to synthesize the leading strand and Okazaki fragments keeps DNA from getting tangled up ahead of the replication fork "unwinds" the DNA double helix at the origin and replication forks 1 ( 9 X 0 0 P + 11 NextDNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence5’-CCG ATC GCA CAA-3’a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codonII. Absence of start codonIII. Due to mutationb) If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)?I. Substitution of C with GII. No changeIII. Deletion of CIV. Both I & IIIThe image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicases, primase, DNA polymerase III, DNA polymerase I, and ligase. Also, be sure to indicate the 5' and 3' ends of all nucleic acid polymers.