23 of 41Which of the following proteins is NOT encoded by a proto-onoogene?O MycO RasO E-cadherinSrcO EGF receptor

A gene that plays a role in proper cell growth. A proto-mutations oncogene's (changes) can turn it…

Answered: 23 of 41 Which of the following…

Science

Biology

23 of 41 Which of the following proteins is NOT encoded by a proto-oncogene? O Myc Ras E-cadherin Src EGF receptor

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 14SQ: Which of the following statements is incorrect? a. Some gene expression patterns can be passed to an...

See similar textbooks

Related questions

Q: 14) this is the serine protein kinase that when activated in a MPF complex that results in…

A: The cell cycle consists of the G1 phase, S phase, G2 phase, and mitotic phase, and is regulated by…

Q: Cyclin D/cdk 4,6 inhibits retinoblastoma protein (Rb) binding to...., which ultimately affects gene…

A: Mutation in RB1 gene causes retinoblastoma. Due to this mutation cell is unable to control growth.…

Q: Describe the nature of p53 reactivation as acancer-fighting strategy

A: Cancer is a condition that arises due to uncontrolled cell division.

Q: 25 of 41 The products of tumor suppressor genes cell division; the products of oncogenes cell…

A: Tumour Suppressor Gene: A tumour suppressor gene is a type of gene that helps control cell…

Q: 24 of 41 The products of tumor suppressor genes cell division; the products of oncogenes cell…

A: Normal genes that slow cell division, fix DNA errors, or warn cells when to die are known as tumour…

Q: Defects in this gene have been associated with metastasis in pancreatic cancer. Select one: O a. APC…

A: Answer : Option "G" is correct - BRCA1

Q: Genistein is a compound found in soybeans that is known to increase the expression of a protein…

A: Breast cancer is a agressive type of cancer with high malignant potential but due to advancement in…

Q: // Which of the following can become oncogenes by over-expression of the normal protein? src O Cip…

A: Introduction :- Oncogene is a gene that is a mutant (changed) version of a normal cell growth gene.…

Q: Expression of S-phase genes is activated when P16 inactive or absent P16 active Cdk4 inactive

A: The cell cycle is regulated by cyclins(regulatory proteins present in varying concentrations during…

Q: What is MPF? A polysaccharide that traps water and forms gels A protein complex involved in cell…

A: As per the honor code, we answer only one question at a time. Therefore, we are answering the first…

Q: Which Is not one of the ways that a proto-oncogene can become converted into an oncogene? O…

A: A proto oncogene is a type of gene which is responsible for suppression of tumor example is p53 Its…

Q: what are the protein products of the following gene: enumerate 2 protein products per number X…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering only the…

Q: ________ are changes to the nucleotides in a segment of DNA that codes for a protein.a.…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Which is a common cause for the production of oncogenes? a. defective ion channel proteins…

A: Cancer The continuous uncontrollable division of defective cell can leads to the cancer.

Q: Which of the following mechanisms cannot activate a proto oncogene to an oncogene? * A single point…

A: A gene that does have the possibility to trigger cancer is known as an oncogene. These genes are…

Q: Which of the following is NOT a typical mechanism by which a proto-oncogene is converted to an…

A: Proto-oncogenes are healthy genes that are found in the cell. They play a very important role in…

Q: What is the function of each of the following genes 1. Leucine zipper transcription factor-like…

A: Gene is the smallest unit of expression at the molecular level. The DNA contains gene that helps on…

Q: Why would a chromosomal translocation that puts a proto-oncogene under the control of a widely…

A: Please follow step 2 for detailed explanation.

Q: You have two patients with pancreatic cancer. Patient 1 has a KRAS oncogenic mutation; a myc…

A: Answer a : - CBP-93872 is the most effective in patients having loss of function mutation for tumour…

Q: What is the importance of determining the patient's onset of menses and the number of pregnancies?

A: MM is 54 year old female. She is diagnosed with intraductal adenocarcinoma of the left breast 5…

Q: Which of the following is a type of genetic change that may producean oncogene?a. Missense…

A: Answers d.) All of the above may produce an oncogene.

Q: Oncogenes: A. Are dominant. B. Cause cells to divide uncontrollably. C. Are mutations of Proto…

A: Cancer is a disease which is caused by the uncontrolled growth of the cells, without regulation of…

Q: ulate the cell cycle called tumar supressors

A: Tumor suppressor genes can be defined as the normal genes that affect the process of cell division…

Q: Igf-2 is maternally imprinted gene in mammals and in Martians. A Martian couple, B@sb&t (female –…

A: The transcription or expression of a gene is where the information in a gene is used to make a…

Q: Which of the following is an example of a proto-oncogene? 1) cell cycle inhibitor 2) tumor…

A: Oncogene The gene that are cancerous and divide cell abnormally.

Q: According to the scenario shown, how many segments of DNA (one, two, or three) are removed during…

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: Under what condition might a human male have the XX sex chromosome complement? It is not possible.…

A: Male develop from Y chromosome because of the presence of SRY genes and SOX9 gene. These genes are…

Q: Describe the changes that can convert a proto-oncogene into an oncogene.

A: A normal functioning gene turns into a proto-oncogene, which can cause cancer when it is altered as…

Q: Match the mutation with the appropriate term. Answers may be u all Results in protein that cannot be…

A: Philadelphia chromosome is a gentica abnornamlity which is due to the translocation between the…

Q: Which one of the following events is unlikely to beassociated with cancer?a. mutation of a cellular…

A: Cancer is basically the uncontrolled proliferation of abnormal or mutated cells in the body. It is…

Q: SCENARIO: MM, a 54-year old female presents to the Family Medicine Clinic due to a 2-week history…

A: Glyburide is used for treating diabetes mellitus type II by the mechanism of increasing the insulin…

Q: The P63 and P53 have similar functionalities in the cell, however, p53 is rarely associated directly…

A: Tumor protein 63 (p63) could also be a transcription factor of the p53 gene family encoded by the…

Q: All of the following are characteristics of oncogenes EXCEPT Multiple Choice they are mutated…

A: Oncogenes have among other properties: They are proto-oncogenes that mutated. They make normal…

Q: What best describes Cdk1? O Is the serine protein kinase that when activated in a complex with…

A: Introduction:- Cyclin dependent kynase are the families of protei They are involved in regulating…

Q: mutations in breast cancer susceptibility genes BRCA1 & 2 principally cause with ? (a) nucleotide…

A: BRCA1 gene mutations lead to breast cancer in women of around 60% to 80%. Along with that it also…

Q: Which of the following proteins is a combinatorial transcriptional regulator in Drosophila that…

A: There are few important points : Combinatorial transcriptional regulator : It is a particular…

Q: what is the role of TERF2 in the deregulation of CDKN1A gene to cause cancer.

A: The basic unit of heredity is the gene, which is a DNA region that codes for a specific protein.…

Q: Which of the following can lead to p53 stabilization and activation? O Hypoxia

A: P53 is a tumour suppressor gene that plays an important role in controlling cell division and cell…

Q: Many oncogenes result from mutations that cause excessive expression of a protein in cells where it…

A: The questions asks to find the correct option for the given statement“Most of the oncogenes arise…

Q: SCENARIO: MM, a 54-year old female presents to the Family Medicine Clinic due to a 2-week history…

A: Introduction:- Breast carcinoma is very common cancer in females and occurs most commonly in the…

Q: Positive cell cycle regulators may become mutated to a. tumor suppressor genes b. oncogenes Cc.…

A: INTRODUCTION Oncogenes These are the gene which have the potential to cause cancer.

Q: Which of the following could be classified as an oncogene? None are possible oncogenes A mutant of…

A: An oncogene is a mutated form of a proto-oncogene normally present in a cell and is involved in…

Q: Is the following true or false AND EXPLAIN: Cells with one functional copy of a proto-oncogene will…

A: In a cell, a proto-oncogene is a normal gene. Many proto-oncogenes exist. Each one is in charge of…

Q: Protein factor rho O binds to the rho utilization site. is part of Rho-dependent termination. two of…

A: The transcription process end with two processes by using RHO protein the one is called the RHO…

Q: What best describes TOR (target of Rapamycin)- O Is a the serine protein kinase that when activated…

A: A cell's growth and its division are a tightly regulated processes controlled by a cascade of…

Q: SCENARIO: MM, a 54-year old female presents to the Family Medicine Clinic due to a 2-week history…

A: Note : Hi. Since you have posted multiple questions. We will solve first one and please repost the…

Q: SCENARIO: MM, a 54-year old female presents to the Family Medicine Clinic due to a 2-week history…

A: Breast cancer is the most common cancer among women. In U.S. 1 in 8 women had invasive breast cancer…

Q: SCENARIO: MM, a 54-year old female presents to the Family Medicine Clinic due to a 2-week history…

A: One of the common form of cancer affecting women is breast cancer. Both the genders get affected but…

Q: SCENARIO: MM, a 54-year old female presents to the Family Medicine Clinic due to a 2-week history…

A: Introduction:- Breast cancer is a very common carcinoma in females and occurs most commonly in the…

Concept explainers

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.

Question

23 of 41
Which of the following proteins is NOT encoded by a proto-onoogene?
O Myc
O Ras
O E-cadherin
Src
O EGF receptor

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

10- 00 O SCNSA-SCN10A CDKN1A HANDI VTI1A SYTI • MYOCD 9 10 11 12 13 14 15 16 17 18 19 20 2122 X Y
A mutated gene that codes for an altered version of Cdk that is active in the absence of cyclin is a(n) ___________ . kinase inhibitor tumor suppressor gene proto-oncogene oncogene.
List the regulatory mechanisms that might be lost in a cell producing faulty p53.
What is the abbreviated name of the human gene that contains the following sequence CAGATTGTGAAGAGGTCTCTTGA? ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3
What is a plausible mechanism for viral oncoproteins? O Promote the expression of pRb phosphatases O Sequester CDK4/6 disrupting interaction with cyclin D O Sequester pRb disrupting interaction with E2F1 OPhosphorylate p53.
The P63 and P53 have similar functionalities in the cell, however, p53 is rarely associated directly with p63, suggesting that p63 may indirectly act as an oncogene by blocking p53 function. This hypothesis may also explain why p63 is associated with other indications of misinterpretation. I do understand the above statement, however once piece not clear – why would p63 block p53 function? Have these genes been shown to have opposing functions? From the background information provided above, it seems like they would have seminar functions. Explain.
Under normal physiological conditions, proto-oncogenes and tumor suppressorshelp control cell growth and proliferation. When mutated, these proteinscontribute to the development of cancer. Briefly detail the molecular basis of thisphenomenon
draw the p21 promoter in a cell with E2F
Gone X is responsible for cell poiteratian and when gene x is expressed, me cells divide e and go through Xhe henmau ceu cycie Wren is not present, proliferanan ends. a) what is oa dominant mutanon that can occur in have a dominant effect on celu proliferation? And wnere in genex waud me mutaion occur li.e.pomoter? ete) gene X gene x not uould b) what is a recessive mutation that can occur in ingene X that would have recessiue effect on prouperation and where in genex would the mutanon occur?
9-10. The IGF2 gene is matemally imprinted, i.e., the matemal copy is not expressed. Expression of the paternal copy is enabled by methylation of a CpG island located between IGF2 and its enhancer. CTCF Maternal igr2 오오오 allele not Enhancer- transcribed Insulator Paternal ig12 9. If you isolated DNA from 20 individual spematozoa, you would expect that: Enhancer allele transcribed a. This CpG island will be methylated in about 10 of them b. This CpG island will be unmethylated in all of them c. This CpG island will be methylated in all of them d. Each sperm will carry one methylated and one unmethylated copy of this CpG island e. None of the above are true
14 of 16 Which experimental technique would be useful in determining whether a particular chemical signal is a paracrine signal or not? Observation of the behaviour of single cells O Gene expression analysis Analysis of blood from nearby capillaries Chemical analysis of the signal molecule Analysis of extracellular fluid from the tissue in question
Which of the following small GTP-binding proteins does NOT play a role in cell migration during chemotaxis? O Cap Z Rho Cdc42 O All of the listed GTPases play a role in cell migration O Rac ◆ Previous