2.Why is it important for eukaryotic DNA to have multiple origins of replication, when a single ori site is sufficient for prokaryotic chromosomes?
Q: Q1. Many of the components for lipid synthesis need to be "activated", which happens by a variety of…
A: Lipids are non-polar biomolecules, which act as the major components of the plasma membrane, energy…
Q: The picture shown depicts what type of compound binding to an enzyme? A) A competitive inhibitor B)…
A: Regulatory enzymes show increased or decreased catalytic activity in response to specific types of…
Q: A. Write the structure of the following peptide at pH 5.0 and calculate its net charge at this pH.…
A: Hi. Thank you for the question. As per the honor code, We'll answer the first question since the…
Q: A drug was developed to inhibit the electron transport chain. How many ATP(s) would be generated by…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: Is it true that there is no such thing as vitamin overdose? For the fat-soluble vitamins, list down…
A: Although dying from a vitamin overdose is exceedingly rare, there were confirmed cases of death due…
Q: Benefits of a project "Drinking Water Refilling Station " to individuals and families and community…
A: Refilling stations for water bottles are now one of the most popular methods of decrease the…
Q: In your own understanding, what do you think is/are the reason why most of the clinical features of…
A: Deficiency disease is described as a type of disease that is majorly caused due to the lack of some…
Q: Identify the reactants, enzymes, cofactors/coenzymes and products involved in the glycolysis…
A: Glycolysis is the metabolic pathway that converts glucose to pyruvate in a series of enzymatic…
Q: Name the functional group present in fructose molecule and kink to water solubility of this sugar.…
A: Sugars come in a variety of forms, some of which are more popular than others. Fructose, like…
Q: 2. Draw out a labeled diagram explaining all the following processes: Gel Filtration Chromatography…
A: Gel Filtration Chromatography: Gel Filtration chromatography is method in which molecules in a…
Q: Which is true about eukaryotic cDNA? Choose all that apply. a. it is constructed from mRNA that…
A: Complementary DNA (cDNA) is made from messenger RNA in the laboratory for various purposes. Because…
Q: what is the Cartagena protocol and how do the articles of the Cartagena protocol regulate the…
A: Cartagena protocol is an international agreement on Biosafety and as a supplement to convention on…
Q: Which of the following is NOT one of the products of the pentose phosphate shunt?
A: The pentose phosphate pathway is the one important metabolic pathways which is take place in most of…
Q: explain why is the importance of pharmacogenetics in the world of forensic sceicn
A: Introduction: Pharmacogenetics is the study of how genetic differences in a single gene develop…
Q: TRUE OR FALSE: a) DNA replication requires the participation of at least 8 nucleoside…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Is taking Multivitamins plus zinc every day affect Our lipid metabolism? If yes, in what way?
A: Zinc, alone or in conjunction with some other recognised antioxidant minerals and vitamins, may…
Q: The fate of glucose in cellular respiration is to yield carbon dioxide. Is this statement true?…
A: Cellular respiration is defined as the process through which different organisms can combine their…
Q: The hydrolysis of a substrate, S, by an enzyme has been studied in the lab. The following initial…
A: Consider the reaction where a substrate 'S' is converted to its product 'P' by an enzyme. The rate…
Q: what are the structural features of protein
A: Protein is most important macromolecule and biomolecule. It is building block of body and providing…
Q: According to the Arrenhius theory, an acid is: a. a substance that forms hydroxide ions b. a…
A: Arrhenius theory gives us the concept of acid and base. This theory is given based on the…
Q: is acetate present in TCA cycle? Are carbon atoms of acetyle-CoA are converted into CO2?
A: The citric acid cycle is an important metabolic process that links sugars, fat, and protein…
Q: What is Diabetes Mellitus?How and why does it occur?
A: Diabetes takes place while the body frame isn't always capable of absorb sugar (glucose) into its…
Q: The melting temperatures of osazones are easily determined and are characteristic for each. Listed…
A: Carbohydrates are abundant biomolecule in the nature. They are polyhydroxy aldehydes or ketones.…
Q: What are the different solid phases that antibody or antigen can bind to, in ELISA?
A: Quantitative immunological techniques that use a solid phase can be defined as solid-phase…
Q: What are the products of the Krebs Cycle?
A: Krebs cycle is one of the most important metabolic pathway. It is also known as citric acid cycle or…
Q: If a cell sample is placed in pure water, what is the concentration of the salt inside the cell?…
A: The water move inside the cell and outside the cell through the process of osmosis. If a cell is put…
Q: What type of glycosidic bond does the shown disaccharide have? HỌ CH,OH O CH,OHO Но. OH Но. OH
A: The above given disaccharide represents the structure of lactose. Lactose is made up of one molecule…
Q: What is the nature of the DNA double helix? Are there other possible conformations of the double…
A: DNA which is acronym of deoxyribonucleic acid it is fundamental unit cell. It is composed of…
Q: Which protein standard curve would you use to read off the protein concentration of an unknown…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. Protein's…
Q: II. A 45-ycar-old man complained of rapid weight loss, tachycardia, increased sweating, occasional…
A: A pheochromocytoma is a tumor in the adrenal gland and causes hypersecretion of hormones from this…
Q: What the world looks like due to mutation?illustrate
A: The mutation causes during the process of replication, transcription, or translation due to…
Q: Enumerate the pathways involved in the metabolism of carbohydrate and give a brief description to…
A: Metabolism of carbohydrates is a biochemical process which involves metabolic breakdown, formation…
Q: Which THREE statements are true about targetting proteins to the nudieua? Aln the cytoplasm, a…
A: Nuclear localization signals mediates the transport of proteins from the cytoplasm into the nucleus.
Q: xplain how the color change occurs with the biuret reagent in the presence of proteins
A: In proteins two adjacent amino acids are linked via peptide bond that is formed between the α amino…
Q: Pls help ASAP, thank you! "Which features of glucose metabolism & regulation in the liver are…
A: The liver plays important role in maintaining the blood glucose levels in the blood. When the blood…
Q: Match the following methods of Anlaysis v Fractional analysis, methylation, and periodate oxidation…
A: Different chemical, physical and enzymatic methods in several applications of biological, chemical…
Q: Name and describe the four weak chemical interaction that occurs in biomolecules.
A: Biomolecules are the essential organic molecules, which are involved in the maintenance and…
Q: E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long?…
A: The genetic code is a sequence of three-letter combinations of nucleotides called codons, each…
Q: CREATE A COMPLETE MEAL PLAN FOR BLOOD TYPE A: INCLUDE BREAKFAST, LUNCH, SNACKS AND DINNER CONSIDER…
A: Blood type diet: Dr. Peter D'Adamo, a naturopathic physician, popularised the blood type diet,…
Q: What type of DNA changes are revealed from p.Gln39X mutation. Is it pathogenic?
A: Introduction: Mutations are the change in the nucleotide sequence of DNA. It may occur in somatic…
Q: In Figure 4C, we see the inhibition of LRRK2 kinase activity by nanobody 1 (Nb1). Using the…
A: The Lineweaver-Burk plot is used for calculating the Vmax and the Km values in the enzyme kinetics…
Q: discuss the biosafety issues involved in the use of genetically engineered microorganism.
A: Biotechnology or genetic engineering where organisms including plants, animals and bacteria or…
Q: What is a folin-ciocalteau reagent and how can it be used to determine the concentration of uric…
A: Uric acid is the end product formed by the catabolism of purine bases. The normal range of uric acid…
Q: Explain how do you prepare a 25-mL solution of 1 mg/mL cholesterol stock?
A: Given Values: Volume = 25 ml Concentration = 1 mg/ml
Q: can you specify what are they positive for? like Positive for Xanthoproteic test (letters)**…
A: Phenols are compounds that have one or more hydroxyl groups attached to a benzene ring.…
Q: 10 b. How many different proteins composed of 100 amino acids could possibly exist?
A: The building blocks for the synthesis of proteins are amino acids. 20 different amino acids…
Q: immunoglobulins. Immunoglobulin Function/s Ig A Ig D Ig E Ig G Ig M
A: Immunoglobulins, a specialised group of proteins that are mostly associated with gamma-globulin…
Q: 3. In the electron transport chain, electrons are transferred to enzyme complexes. Name the…
A: The electron transport chain occurs in mitochondria. ETC is a pathway in which the reducing…
Q: Please answer post lab question and give a conclusion about the experiment
A: Browning of potatoes is caused by the polyphenol oxidase enzyme. In the presence of oxygen, the…
Q: Explain how the position in the active site and function of the oxyanion hole of chymotrypsin…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Step by step
Solved in 2 steps
- 1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication7. What enzyme synthesizes small primers for DNA polymerase to bind to so it can initiate DNA replication. What are these primers made of? To answer the question please: I) name the proteins that are required for DNA replication; 2) draw a scheme of DNA replication; 3) design a primer for this DNA fragment: 5'-AATTGGCA-3,3) 6. What is the main reason for there being both a leading and a lagging strand during DNA replication? To answer the question please: traw a scheme of DNA replication and mark the direction of replication fork movement; 2) name the proteins that are required for DNA replication. monar initiate
- 1. Name all the proteins that are in the DNA replication fork in E. Coli, and describe the functions of these proteins. Explain how two DNA strands are replicated at the same time by one replication fork.5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the other one will go from 5' to 3' direction. During replication or transcription, whatever the process is, it will always follow the 5' to 3' direction using the 3' to 5' directed strand as the template strand. Therefore, if following is the DNA sequence 5'-CCG ATC GCA CAA-3' a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codon II. Absence of start codon III. Due to mutation b) If you want to start the translation, what change you need in the second codon (from 5' to 3' direction)? I. Substitution of C with G II. No change III. Deletion of C IV. Both I & III21. During replication one of the parent strands is oriented 3' to 5' direction toward the replication fork and the synthesis of the new strand can continue without interruption as the helicase continues unwinding. The other parent strand runs 5' to 3' direction leaving the synthesis of the new strand to continue in the opposite direction and away from the replication fork. This causes generation of DNA fragments to be attached later. This strand is called lagging strand. True False
- 1.Make a flow diagram to describe each of the prokaryotic DNA repair mechanism 2. Give 2 examples of DNA damage and explain the impact the damage has on the sequence2. What is the difference between the old and the new DNA strands? 3. What process invoives the production of MRNA using DNA as template? 1. In the Central Dogma, what process involves the production of a new DNA strand using an old DNA strand as blueprint or template? * How is replication different from transcription in terms of product? 5 What do you call each triplet code made up of three linearly arranged nucleotides in the MRNA? 6 What is the complement of the mRNA tripiet code in the tRNA? 7 In what way is tRNA different from MRNA? 8 In what ways are RNA and DNA similar? 9. In what ways are they different?31. During DNA repair in both prokaryotes and eukaryotes, which of the following enzymes forms a phosphodiester bond between the undamaged DNA sequence, and the newly synthesized DNA section, after the correct nucleotides have been linked together to replace the damaged nucleotides? RNA polymerase DNA helicase an exonuclease DNA ligase topoisomerase
- 11. Refer to the figure showing a single replication fork. Which statement about the replication fork shown is false? O The replication fork is advancing to the left. O The top template strand is oriented in the 5'-to-3 direction from left to right. O DNA polymerase would be "reading" the top template strand from right to left. The origin of replication is at the position labeled A.1. As DNA engages in semi-conservative replication, explain what the following enzymes roles are in this process. ✓✓✓✓ DNA Polymerase II: DNA Helicase: DNA Ligase: Primase:23. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices 1. G 2. C 3. A 4. T
