2. Determination of the molecular weight of proteins. A student performs a protein separation in the laboratory using electrophoresis. For protein A he obtained a migration distance of 5.8 cm, while for protein B he obtained a migration distance of 9.6 cm. From these results we can say the following Choose one: a. Protein A is positively charged and protein B is negatively charged. b. Protein B is smaller than protein A. C. Protein A is negatively charged and protein B is positively charged. d. Protein A is smaller than protein B.

2. Determination of the molecular weight of proteins. A student performs a protein separation in the laboratory using electrophoresis. For protein A he obtained a migration distance of 5.8 cm, while for protein B he obtained a migration distance of 9.6 cm. From these results we can say the following Choose one: a. Protein A is positively charged and protein B is negatively charged. b. Protein B is smaller than protein A. C. Protein A is negatively charged and protein B is positively charged. d. Protein A is smaller than protein B.

Organic Chemistry: A Guided Inquiry

2nd Edition

ISBN:9780618974122

Author:Andrei Straumanis

Publisher:Andrei Straumanis

Chapter27: Amines

Section: Chapter Questions

Problem 14E

See similar textbooks

Similar questions

Most of the ultraviolet absorption of proteins at 280 nm is due to their content of a. Glutamate b. Tryptophan c. Alanine d. Aspartate
Macmillan Learning Complete the Ksp expression for Ag₂CO3. Ksp = 8.46 × 10-12 = MacBook Pro Search or type URL
Answer Q26, 27, 28
In polarimetry when the sugar is heated for 60 mins instead of 30 mins hwat happens to the extent of inversion, will it lower or higher or cannot be determined?
Ramachandran plots for two amino acids differ significantly from that shown in Figure 2.23. Which two, and why?
LEKS X A ALEKS-Allie Fleming - Learn X + wu.aleks.com/alekscgi/x/Isl.exe/10_u-IgNslkr7j8P3jH-IQUHIQg6bJxmeSyVpHOEB1plef9xyC5Ca9QIFwtxr00buHbeXUZhX-WNTXJ1_nmqsj0g EocTE5oCPLW220suaHKGGrEdkEV2?10... # 3 E O ADVANCED GENERAL CHEMISTRY Using the general properties of equilibrium constants At a certain temperature, the equilibrium constant K for the following reaction is 0.0056: N₂(g) + O₂(g) 2 NO(g) Use this information to complete the following table. Suppose a 18. L reaction vessel is filled with 0.40 mol of NO. What can you say about the composition of the mixture in the vessel at equilibrium? $ V What is the equilibrium constant for the following reaction? Round your answer to 2 significant digits. 2 NO(g) N₂(0)+ O₂(9) What is the equilibrium constant for the following reaction? Round your answer to 2 significant digits. 3 N₂(0)+30₂(0) 6 NO(g) Explanation -- A 59 R F 1/ 48 % Check 5 ■ T G d- ^ Q Search 6 4+ Y H & 7 all fo O There will be very little N₂ and 0₂. O There will be very…
Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give clear handwritten answer in 2 figures)
/evo/index.html?deploymentld=D55750828934189288909969212&elSBN=9781305657571&snapshotld=2199898&id%3D1.. O To * MINDTAP Q Search this ca Use the References to access important values if needed for this question. The amino acid glycine has the molecular formula C,H5NO2, and the amino acid isoleucine has the molecular formula CH13NO2. Determine how many moles of isoleucine contain the same number of atoms as 1.97 mol of glycine. moles • Submit Answer 5 question attempts remaining
Pre-Lab Questions 1. Define a protein, and describe one important function of proteins in the human body. 2. The following data were obtained from a Bradford assay to determine the protein content in a sample: Protein content (ug) Absorbance value 0 0.000 2 0.022 5 0.065 10 0.106 20 0.178 30 0.299 40 0.380 50 0.472 unknown 0.150 Use Excel, another program, or graph paper to produce a calibration curve based on the data. Use linear regression (or best fit line) to obtain the slope of the line. Determine the unknown protein content for a sample that shows an absorbance reading of b. С. 0.150.
What is the ratio of CATION to ANION in Drug X? [blank1] H₂C -H Fogy CH3 SO42 'N CH3 Drug X CH3NH Describe the possible interactions between the SIDE CHAINS of amino acids: I. and II.... II. and III... I. and III... 1. COO NH3* 2 HO II. COO HO NH3* COO NH3* III.
Among these protein assays, which work in acidic conditions? a. Biuret assay b. Bicinchoninic acid assay c. Bradford assay d. Lowry assay
macollege.instructure.com/courses/352/pages/covid-proteins-lab-manual?module_item_id=D44333 A = abc Where "A" is absorbance, "a" is molar absorptivity, "b" is the path length (length of the cuvette in units of cm), and "c" is concentration (mol/L). The molar absorptivity is an intrinsic property of a molecule which tells us how intensely it will absorb at a particular wavelength. If "A" is a unitless quantity, "b" is in units of cm, and "c" is in units of mol/L, then what are the units of molar absorptivity? Do a little research to learn how alpha-helices and beta-sheets are drawn in protein structures. If most of the absorption properties are coming from the alpha-helices in these proteins, and many alpha-helices have similar absorbance properties across different proteins, which protein would you predict would have the highest molar absorptivity? Your job is to use the following data table to determine the molar absorptivity for each of the following proteins at their respective…