16. Tamaraw has been in the critically endangered list since the year 2000. One of the reasons is the habitat destruction that forced them to move further inland into the thick forest. Which of the following factors affect the population of the tamaraw? *       A. disease and parasites       B. emigration       C. predation       D. competition for resources 17. What conservation status is referred when there is no reasonable doubt that the last individual has died such as to what happen to the Saber-toothed tiger and Dodo? *       A. Endangered       B. Extinct       C. Vulnerable       D. Critically endangered

Q: All of the following are included in the six kingdoms of life, EXCEPT: *   A. plantae B.…

A: Cavalier Smith was first to proposed the six kingdom classification in 1998. This system classify…

Q: The beautiful red postman butterfly (Heliconius erato), shown below, has 21 pairs of homologous…

A: The gametogenesis is the process of formation of gametes. This gametes are formed on the basis of…

Q: Choose and describe a scientific technique or practice related to genetics and eugenics. Provide the…

A: The chromosomes are made up of DNA (deoxyribonucleic acid) molecules that carry genetic information.…

Q: What tree below represents the consensus tree for the two trees above?

A: * consensus tree is a phylogenetic tree which summarizes the branching information of a set…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: By base-pair substitution, what are all the synonymouschanges that can be made starting with the…

A: The example of CGG is RNA codon which transiently binds with the transfer RNA by simple base pairing…

Q: Which of the following dephosphorylates PI 3,4,5-trisphosphate, thereby blocking the activation of…

A: The survival and growth is promoted by the PI3K-Akt signaling pathway. Protein Kinase B and…

Q: Did your recombinant DNA have more than one insert? What was the orientation of the insert(s)? Make…

A: *Recombinant DNA technology is to transfer genes from one organism to another or changing genes by…

Q: 3. Bacteria and eukaryotic organisms are very compact; yet, they carry on all the processes of life.…

A: This question is about eukaryotic organisms.

Q: below. What can we learn from this experiment about the rhythmicity of our cardiac muscle? List…

A: Cardiac muscles are the specialised involuntary muscles observed around the heart and are…

Q: Drugs that increase urine flow (diuretic drugs) are oftenemployed in the treatment of hypertension…

A: Kidneys are composed of units called nephrons.

Q: Which of the following statements accurately describes the current state of biodiversity on the…

A: Biodiversity in an area depends on the number of species present in the area and the number of…

Q: .... Several set of terms are used to indicate the direction and position when describing the…

A: Some standard anatomical terms of location are used to describe the anatomy of animals including…

Q: The human microbiome is an integral part of human health. Unfortunately, the microbiomes of…

A: The gut microbiota is the microorganisms, including bacteria and archaea, that live in the digestive…

Q: Which of the following are common types of data/analysis that are used in bioinformatics. O DNA…

A: Answer :- Option (A) is correct. - DNA sequencing.

Q: Describe carbon and carbon bonding, how monomers become polymers using dehydration reactions, and…

A: Carbon is the 6th element in the periodic table with 4 valence electrons. It has the unique ability…

Q: d. A given molecule of ATP can be broken down to ADP + P close to 1500 times in a day ("ATP cycle").…

A: ATP cycle produce energy for cells to do work. ATP is generated and energy is transported to where…

Q: Name and describe the three domains of living organisms

A: The three domain system is a biological classification introduced by Carl Woese. This system is…

Q: 4.What is the fate of the fertilized ovule of a flower? Read and analyze the question and choices…

A: Flower is most conspicuous , fascinating, fragranted part of plant and is major characteristic of…

Q: . Defense scientists at the United States Army Research Institute of Environmental Medicine…

A: For performing a scientific experiment we need to determine the dependent, independent and control…

Q: Which of the following models of sexual selection may result in phenotypes that are not beneficial…

A: Sexual selection is the process by which certain organisms produce more offspring by mating more…

Q: One of the important skills that must be acquired by the teaching staff in the health field…

A: Introduction Healthcare is the efforts made to maintain or restore emotional, mental, or physical…

Q: Which zone actively produces new root cells by means of mitosis?Read and analyze the question and…

A: The formation of roots begins with the germination of seeds. When the plant embryo emerges from the…

Q: The first step leading to allopatric speciation is (a) hybrid inviability(b) hybrid breakdown (c)…

A: Speciations are the process in which species evolve into something so drastically different than…

Q: e at least five different deficiency symptoms in plants. Describe them and correlate - with the…

A: Since the inorganic elements required by the plants are cheifly obtained from the soil where they…

Q: Define RQ. What is its value for fats?

A: Introduction In this question we have to define Respiratory quotient.

Q: 18. Which statement is TRUE about population? *       A. The population growth in an ecosystem must…

A: The organisms living in an environment is termed as a population. The population can range from a…

Q: Which are thought to have evolved first, aerobic bacteria or photosynthetic bacteria? Explain.

A: There are two main types of bacteria, aerobic and anaerobic. Aerobic bacteria need oxygen to…

Q: p. The forward reaction would be written as: Please select the correct letters from graph (a-e) to…

A: Enzymes are biological catalyst. It catalysed all biological reactions that maintains homeostasis.…

Q: • Draw a cyanobacteria cell. • Label the parts of the cyanobacteria where the metabolic processes…

A: Introduction Cyanobacteria are also known as blue-green bacteria are a phylum of Gram-negative…

Q: An organism's life history traits influence its... O Diet O Reproduction O Survival O Reproduction…

A: The pattern of survival as well as reproduction events that take place during the life of an…

Q: What is oxidative phosphorylation?

A: Oxidative phosphorylation takes place in the elctron transport chain of the mitocondria. This…

Q: Which component of cell division machinery is frequently targeted by anti-cancer drugs? Can you…

A: INTRODUCTION Cancerous tumors are characterized by uncontrolled cell division, which is absent in…

Q: By looking at a plant externally can you tell whether a plant is C3 or C4? Why and how?

A: Introduction We will answer this question in below step.

Q: Give an example of genetic traits. Explain 2.Give an example of genetic disorder. Explain

A: An inherited trait or genetic trait is a trait that is received by an organism from its parents.…

Q: Write down the reasons why there are more than one active/passive transport system in most bacteria…

A: Active transport is defined as the movement of molecules across the cell membrane by using cellular…

Q: What is the importance of plasma proteins?

A: Plasma, also known as blood plasma, is a light-yellowish or straw-coloured fluid of blood that helps…

Q: State the volume of air remaining in the lungs after a normal breathing.

A:

Q: Which is true about non-vascular plants?Read

A: Nonvascular plants are called bryophytes. Nonvascular plants include liverworts, hornworts, and…

Q: Which of the following statements is correct regarding the experiments performed by Roger Payne? The…

A: * Roger Searle Payne is an American biologist and environmentalist famous for the discovery of whale…

Q: The brain stem also includes the bulb-like

A: The swollen part of the central nervous system located in brainbox having cavities filled with…

Q: . In a normal individual, heart rate can be determined by the in an ECG.

A: ECG stands for Electrocardiogram.  It is a test which measures the electrical activity of heart.…

Q: The fluid regulation of the body is through___________

A: The fluid regulation of the body maintains the water homeostasis. The major intake of water is…

Q: Question 5: Describe the role of liver, lungs and skin in excretion.

A: Furthermore, the liver, the lungs, and the skin all play an important role in the process of…

Q: outline major stages in life evolution, and describe how the landsurface changed as life evolved.

A: The period from 4600 mya to 2500 mya is called Archean eon.

Q: A fellow classmate is planning to study endocytosis at neuronal synapses for their senior thesis. He…

A: Endocytosis is described as a the process in which the cell membrane's flexibility helps them in…

Q: Compare the prebiotic soup hypothesis with the iron–sulfur world hypothesis.

A: Both prebiotic soup hypothesis and iron sulphur world hypothesis were given by different scientists…

Q: . Can a missense mutation of proline to histidine bemade with a G • C → A • T transition-causing…

A: A missense mutation is a point mutation that occurs in a codon that codes for a different amino acid…

Q: On the planet RAMA, the DNA is of six nucleotide types: A,B,C,D,E,F. A and B are marzines, C and D…

A: A) DNA model of RAMAN DNA :  •The DNA model of RAMAN DNA consists of three strands of DNA connected…

Q: Problem 7: Consider three neuron nodes: S1, S2, and S3 with thresholds T1, T2, and T3 given as…

A: A potential energy surface (PES) describes the potential energy of a system, especially a collection…

Conservation Biology

The study of how to prevent the loss of biological diversity on the planet is called conservation. Biological diversity, also termed biodiversity, consists of various life forms found in a specific location or across the entire planet, including ecosystems, species, populations, and genes. Conservation thus aims to protect the diversity of life at all levels of biological organization.