11. What is a typical characteristic of an r-selected species? a. boom-and-bust popuation growth curve b. constant survivorship curve c. early loss survivorship curve d. high reproductive rate e. late loss survivorship curve f. lives in stable environoment g. low death rate h. short life span i. small body size j. stable age pyramid

Q: Biology ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once…

A: The goal of the study is to use techniques to achieve the goal. During the process, information…

Q: Discuss the mechanical and chemical digestion of starch, protein, and fat, describing all the steps…

A: Introduction Digestion is the breakdown of large water-insoluble food molecules into small…

Q: Occasionally, a person is found who has one blue eye and one brown eye or who has a sector of one…

A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by…

Q: Are Invasive Species All Bad?

A: Invasive species are the Exotic species which are introduced to a new habitat they have the ability…

Q: You and your lab partner ran a simulation to demonstrate the changes in allele frequency over time…

A: Allele frequencies in large and small population.

Q: Which of the following is NOT a bone of the appendicular skeleton? O the scapula O a rib a…

A: According to the question, we have to find out which of the following is Not a bone of the…

Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…

A: A calico cat is a domestic cat of any breed with a tri-color coat.

Q: Which of the following best describes the function of telomerase? a. The telomerase uses its RNA…

A: Which of the following best describes the function of telomerase  Answer :  a. The telomerase uses…

Q: Transcription factors are allowed to enter and exit the nuclease at all times. 1 A▾ B I U S X₂ x² $$…

A: The above statement is true.

Q: Which color is obtained when protein is treated with Ninhydrin solution? A. Purple B. White C.…

A: In this  question we have to describe about protein detection test.

Q: The stage micrometer is 1 mm long with 1000 divisions. Under HPO, aligning it with an eyepiece…

A: In the microscope, there is a stage ruler and an eyepiece ruler. The image size of any specimen is…

Q: Select the correct statement about cardiac output. A slow heart rate increases end diastolic…

A: Introduction  Cardiac output is calculated by multiplying the stroke volume by the heart rate. The…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: This muscular blood vessel regulates blood pressure an blood flow to the capillaries. O Arteriole O…

A: Answer is arteriole

Q: ? Which one is true For few seconds the blood supplies CO2 to cells and picks up 02. For few mints…

A: Blood Supply of Heart The heart receives its own supply of blood from the coronary arteries. Two…

Q: if you are going to prepare 15 plates of Nutrient Agar, 30 NA slants, and 20 NA stabs, how much tap…

A: In usual labs petriplatea can hold 15ml of media therefore for 15plates approximately 15×15 = 225ml…

Q: Two corn plants are studied. One is resistant (R) and the other is susceptible (S) to a certain…

A: Maternal Inheritence It is a kind of inheritance which does not follow Mendelian in pattern of…

Q: Select the correct answer for each question.  Explain why you chose that answer as opposed to the…

A: The vagus nerve is the tenth cranial nerve which is also the longest mixed cranial nerve. It carries…

Q: 11. A lecture hall of 1000 students conducts the same allele frequency simulation that we conducted…

A: Allele frequency:  The allele frequency is a measure of genetic variation. It generally shows us…

Q: This blood vessel carries blood away from the heart. O A. Artery O B. vein O C. venule O D.…

A: Blood circulate throughout your body with the help of certain vessels known as blood vessels.  Thus…

Q: Writing a Full Strand: 1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT…

A: DNA  It is a nucleic acid which carries genetic information that gets passed from one generation to…

Q: Select the correct statement about the function of myocardial cells. Cardiac muscle cells are…

A: Introduction The absolute refractory period of muscle cells refers to the time following a muscle…

Q: The lungs perform other :physiologic functions Play secondary role in heat exchange and fluid…

A: The lungs are a crucial organ of the body. They are quite spongy and are filled with air with the…

Q: What is the importance of feedback systems in the control of hormonal output in mammals? Offer two…

A: A feedback mechanism is a loop in which a product feeds back to control its own production.

Q: The Gulf of St. Lawrence is home to the beluga whalesThere once were thousands of belugas in this…

A: Bio accumulation: It is increase of contaminant concentration in aquatic organisms following uptake…

Q: Biology ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once…

A: Information gathering and literal search are usually done in research processes. It is the process…

Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…

A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…

Q: Increasing environmental temperature has which of the following effects on mosquitoes and arthropod…

A: ANSWER;-c) The frequency of blood-feeding by females increases.

Q: 6. What amount of oxygen represents the gross primary productivity of the algae? a. 7 b. 2 c. 5 d.…

A: The amount of oxygen dissolved in water for the organism is referred to as dissolved oxygen (DO).…

Q: Please answer asap and type your answer and do not copy from anywhere please In a study published in…

A: A keystone predator is one which "prevents a particular herbivorous species from eliminating…

Q: What are the similarities between feminist ethics and African ethics

A: Ethics is also called moral philosophy. It is described as a discipline that is concerned with what…

Q: First letter U U UUU UCU UAU UGU UUC UCC Tyr Cys UAC UGC UUA UCA UAA STOP UUG UCG UAG STOP UGA STOP…

A: Introduction Gene expression is the process through which information from a gene is used to create…

Q: 56 Platt and Glimcher found that the firing of neurons in the lateral intraparietal area are…

A: The lateral intraparietal area is located in the intraparietal sulcus of the brain and this region…

Q: Topic:Excretion in animals Study a model or diagram of a frog’s, bird or lizard’s and human…

A: The excretory products include amino acids, urea, uric acid, carbon dioxide, water, and ammonia. The…

Q: Briefly describe a generalized plant embryogenesis

A: Introduction The process of forming and developing an embryo from a zygote (zygotic embryogenesis)…

Q: Which embryonic germ layer lines the outer surface of the embryo

A: An embryo is the early stage of human development in which organs form critical body structures.

Q: What is the name of the "law" described by the formula in (1) (where R is how related two…

A: The reproductive benefit here means that one organism can pass its genes to future generations by…

Q: Study the diagram below to identify the pressure relationships which are present during VENTRICULAR…

A: During first part of ejection ventricular pressure rises blood is intensively ejected to the…

Q: You were asked to invent substitutes for blood vessels (artery, capillary, and vein). What materials…

A: To produce the vascular prostheses, polymer solutions were spun in an electrical field to form very…

Q: In endochondral ossification, bone is formed from a template composed of: O epithelial membrane O…

A: Endochondral ossification is a embryonic process where bone starts formation by using hyaline…

Q: Gene flow can have one effect in the context of a single population, and a different effect in the…

A: Gene flow is the movement of genes or alleles between populations separated by geography. The…

Q: Human beings belong to both the hominid and hominin clades. O True O False

A: The Hominidae, whose members are known as the great apes or hominids, are a taxonomic family of…

Q: 3. Have you heard about cellular memory? 4. Do you think that an organ recipient's personality and…

A: Genetics is the study of the functioning and main codes of variation and heredity. Inheritance is…

Q: 3. Albinism is a recessive trait. Determine the genotypes of the parents and offspring. a. A normal…

A: Albinism is a autosomal recessive disorder. To express this disease two recessive alleles are…

Q: To determine: The reason why most enzymes do not operate at their biochemical optima inside cells.

A: All enzymes share three characteristics. They are distinct in their specificity, regulatory ability,…

Q: To explain: one or more possible explanations for the slower rate of evolutionary change in the…

A: Organisms are classified as aerobic or anaerobic based on their reliance on oxygen. Biomolecules…

Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…

A: Calico cats have tricolour coat. Their colouring is related to the X chromosome that's why they…

Q: . A defective white blood cell does not complete the process of DNA replication. Which of the…

A: In order for the replication of DNA to occur there is a definite sequence of cell cycle that has to…

Q: in your own words Sensory organs are essential anatomical features that helped lineages of…

A: Examples :-   Birds   are warm-blooded, and, although most are capable of flight, others are…

Parasitic infections

A parasite is an organism that lives in the body of another organism and obtains food at the expense of the host. There are two kinds of parasites they are internal and external. An internal parasite lives inside another organism and is known as endoparasite. An external parasite lives on the body surface of the host and is known as an ectoparasite.