1 pts List the following events in order as they would occur inside a skeletal muscle fiber: 1) cross-bridge 2) action potential (AP) arrives at the motor end plate 3) AP travels down the t-tubule 4) calcium pumped into sarcoplasmic reticulum 5) opening of voltage-gated calcium channels O 2, 5, 4, 3, 1 O 5, 1, 2, 4, 3
Q: Describe the various functions of the thyroid gland. Creat a data table comparing and contrasting…
A: The thyroid gland is a butterfly-shaped gland located immediately above the collarbone in the neck.…
Q: I1. Electrical impulses in muscle fibers are called 12. Groups of muscle fibers are that are…
A: The movement of skeleton muscles is voluntary in nature and regulated by central nervous system.…
Q: 4. The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…
A: Alternative splicing of precursor mRNA is an essential mechanism to increase the complexity of gene…
Q: Discuss the principles and applications of Laser-Doppler Anemometer to Agricultural and Biosystems…
A: Laser-Doppler anemometers (LDAs) are non-intrusive optical instruments that can be used to measure…
Q: You have now studied three different types of anatomical structures. Homologous structures show…
A: Comparative anatomy is the study of the "similarities and dissimilarities" between various objects.…
Q: What is the final electron acceptor for anaerobic organisms? What does this mean
A:
Q: 3. How is population growth depicted? 4. What are the applications of knowing limits to population…
A: Ecosystems provide foods, medicines, and energy, they regulate nutrient recycling and waste, they…
Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…
A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…
Q: Order the listed proteins in the correct order so that cell proliferation is activated as the…
A: HGF stimulates epithelial cell proliferation, motility, morphogenesis via tyrosine phosphorylation.…
Q: If chaetognaths belong to Lophotrochozoa, they would be more closely related to animals like…
A: Chaetognaths are phylum of the predatory marine worms.
Q: butterfly wing bird wing un What is the function of each of these structures? How are they different…
A: Analogous are comparable attributes shared by two unique creatures as a result of convergent…
Q: What is the role of glial cells in the brain and other parts of the nervous system?
A: Introduction :- Glial cells, also known as neuroglia, are cells that surround and support the…
Q: On a separate sheet of paper. A. Classify the Value of Biodiversity: Give the value of each organism…
A: INTRODUCTION Biodiversity is referring to the diversity of living organisms that are interdependent…
Q: On the right of the replication fork, which DNA strand (top or bottom) will be the template for…
A: Okazaki Fragments these are short stretches of DNA produced by a discontinuous synthesis of the…
Q: What is Biological classification? What is the need of classification?
A: The naming of organisms by two words is referred to as biological classification. One is a generic…
Q: Explain sexual reproduction in bacteria?
A: Despite the fact that bacteria do not have true sexual reproduction, they exhibit genetic…
Q: a. Identify the following elements on the diagram. Aminoacyl site (A) Peptidyl site (P) Exit site…
A: During translation, a ribosome contains 3 different RNA binding sites: A site is an aminoacyl or…
Q: List and describe three changes in muscles that occur duringendurance training and explain how each…
A: Three changes in muscles that occur during endurance training are: a slower utilization of…
Q: why is polyspermy lethal in an egg cell?
A: Polyspermy is defined as the introduction of two or more sperm cells into the cytoplasm of an egg.
Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…
A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…
Q: Why do signals indicating damage to cells result in increase in the expression of p21Cip1?
A: P21cip1 is small 165 amino acid protein that mediates p53 dependent G1 growth arrest.
Q: Describe the major climate during your time era. Climate mainly includes average temperatures and…
A: Climate:- Climate is defined as conditions prevailing in an area for a long period of time.
Q: Provide names of two molecular chaperons and their functions for MHC I antigen presentation pathway
A: MHC class I molecules are comprised of a polymorphic transmembrane heavy chain and a soluble protein…
Q: 6. Consider the following biochemical pathway: precursor compound I enzyme enzyme A В compound II…
A: The fungus Neurospora was used by Beadle and Tatum to manipulate the biochemical outcomes of…
Q: If a population is experiencing directional selection with respect to wing color, what type of…
A: Natural selection drives the process of evolution.
Q: How do mitochondrial proteins interact with IAPs to prevent inhibition of apoptosis?
A: Multicellular organisms experience apoptosis, which is a type of programmed cell death. Cell death…
Q: 21. Which macromolecules always contain carbon, hydrogen, oxygen, nitrogen, and sulfur? A. nucleic…
A: Introduction:- Any exceedingly big molecule with a diameter ranging from roughly(105 to 103 mm) is…
Q: Outline the events in the innate and adaptive immune responses, from when a pathogen invades to…
A: Introduction Immunity: it is the property/capability of our system to fight against the harmful…
Q: explain about the genetic drift -differentiate founder effect from bottleneck effect.
A: Evolution is a steady phenomenon which bring about transformation of life from much simple one to…
Q: How do studies of brain development in knockout mice support the statement that apoptosis is a…
A: Apotopsis is a process of programmed cell death. It is a process in which the cell division is…
Q: _______________ refers to the chance that a disease genotype produces a disease phenotype.
A: The phenotype can be described as an organism's visible physical features, such as its structure,…
Q: How can researchers test the hypothesis that clinal variation among populations of a particular…
A: A gene is a functional unit on a chromosome that is passed down from parents to offspring in order…
Q: Transcription occurs along a_template forming an MRNA in the _direction. * O none of the above O 5'…
A: The central dogma explain how the DNA codes for the proteins which proceed in three stages namely…
Q: Are there any parts of the human body that get oxygen directly from the air and not from the blood?
A: *oxygen is an important gases for human body each cell in human body requires amount to oxygen for…
Q: Which division of meiosis (meiosis I or meiosis II) a. most resembles mitosis? b. cuts the…
A: a.Meiosis II. b. Meiosis I. TELOPHASE I. c. Meiosis I. TELOPHASE I. d.Meiosis I
Q: if you know the amino acid sequence of a protein can you predict with 100% certainty the DNA…
A: Codon is the genetic code that is formed by permutations and combinations of three nucleotide…
Q: B5. When a tapeworm obtains nutrition from the human intestine, but causes harm to the human host in…
A: Different types of species interactions are found that are classified according to their nature. In…
Q: What are the concepts behind osmosis and enzymatic browning in potatoes?
A: Osmosis is the movement of water or other solvents across a semi permeable membrane from a region of…
Q: Do all reflexes require sensory inputs from the same muscle bundle?
A: Introduction Sensory input is the stimulation of a sense organ, causing a nerve impulse to travel to…
Q: Appreciate the role of ethics in environmental science, andcompare and contrast major approaches in…
A: Environmental science is defined as the study of environment on the basis of physical, geographical…
Q: What is false about the image below? The cells are part of plant ground tissue B) The cells are…
A: * Ground tissue is all tissue in a plant include parenchyma and collenchyma and schlerenchyma. *…
Q: Why is it sufficient to stain cells from a SDA (Sabouraud Dextrose Agar) plate with crystal violet…
A: Introduction : Sabouraud agar, often known as Sabouraud dextrose agar (SDA), is a peptone-containing…
Q: Are there any safety concerns with teaching a cat in this way?
A: Learning is defined as any relatively permanent change in behaviour that occurs as a result of…
Q: Sketch a diagram to illustrate the interaction between MHC I molecules of the named cell type and…
A: The MHC I molecules are the major histocompatibility complex I which are present on the surface of…
Q: 1. How do demographic factors affect population size? 2. Are the effects of these factors mutually…
A: Demography is the statistical and mathematical study of the size, composition, and spatial…
Q: 1. A woman is colorblind. Construct a Punnett square and using versions of the letter “C” determine…
A: As per our company guidelines we are supposed to answer only first question or first 3 subparts of…
Q: Dicuss a strategie for Diabetes in the UK.
A: Blood glucose is the main source of energy and it comes from the food we eat. Diabetes is a disease…
Q: In 1984, Carolyn Greider was using out the enzyme called telomerase that had the ability to add…
A: Chromosomes are the structures formed by the organised arrangement of the DNA molecules located…
Q: Describe the trend/pattern in the frequency of M as the population undergoes the following:
A: Key points: Microevolution is a change in the frequency of gene variants, alleles, in a…
Q: 14. The plasma membrane of a muscle fiber is called a 15. A myofibril consists of and filaments that…
A: The muscle tissue is one of the basic tissue in the body that is responsible for contraction and…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1.) What is the outcome of decrease Calcium ions in the body in muscle contraction? 2.) What is the normal body pH?24) which of the following is not a function of the skeletal system? a) storage of minerals b) communication to muscle or glands c) support d) production of blood cells( hemotopoiesis)3. The calcium that permits neurotrasmitter release from the alpha motor neuron is recycled and used as calcium that becomes available for the muscle contraction. A)False B)True
- Which of these is the proper sequence of these events of muscle contraction 1) Action potential propagating down into the T-tubule 2) Power stroke 3) Ca+2 is released from the sarcoplasmic reticulum 4) The tropomyosin shifts out of the way thereby exposing the active sites of the actin Question 7 options: a) 1 à 3 à 4 à 2 b) 4 à 3 à 2 à 1 c) 1 à 4 à 2 à 3 d) 3 à 1 à 4 à 2A) tetany is rapid spasm in the muscle. B) Tetany is usually caused by an increase in the blood calcium levels. Write whether statement (B) is correct w.r.t statement (A) ?3) Paula is a scientist who is developing a drug called Fremtol that will be used to treat muscle spasms. This drug acts on specific skeletal muscles to (1) block the release of Ca2+ ions from the sarcoplasmic reticulum, (2) inhibit the pivoting ability of the myosin heads of the thick filaments, and (3) block the production of ATP by the mitochondria in skeletal muscles. By using this drug, contraction of certain skeletal muscle fibers is reduced, which keeps those muscles from producing spasms. In the above scenario, Fremtol’s effect of blocking muscle mitochondrial ATP production would result in the inability of the muscle to make ATP from ___________. a. creatine phosphate b. anaerobic glycolysis c. aerobic respiration d. All of the above e. None of the above
- 2) Paula is a scientist who is developing a drug called Fremtol that will be used to treat muscle spasms. This drug acts on specific skeletal muscles to (1) block the release of Ca2+ ions from the sarcoplasmic reticulum, (2) inhibit the pivoting ability of the myosin heads of the thick filaments, and (3) block the production of ATP by the mitochondria in skeletal muscles. By using this drug, contraction of certain skeletal muscle fibers is reduced, which keeps those muscles from producing spasms. In the above scenario, Fremtol’s effect of blocking the release of Ca2+ ions from the sarcoplasmic reticulum would most directly prevent which the following? a. activation of tropomyosin b. activation of troponin c. activation of actin d. All of the above e. None of the aboveThe transverse tubular system:A)speeds the transmission of an action potential down the length of a fiber.B)activates only one myofibril at a time.C)allows the deeper myofibrils to receive the effects of action potentials quickly. D)enables the rapid transport of lactic acid away from the muscle. E)allows for individual sarcomeres to contract independently Of the other.3) In order to excite a skeletal muscle, the neurotransmitter must bind to: a)calcium channels. b) potassium channels. c) sodium channels.
- 16) when a skeletal muscle contracts, it usually moves the bone at one end much more than the bone at its other end. The attachment of the muscle to the less moveable bone is called its a) insertion b) ligament c) origin d) flexor1. Draw and label the steps of the sliding filament mechanism in skeletal muscle. This should be four parts (Cross- bridge, power stroke, disassociation, reactivation). On each part, be sure to include the following structures: actin, myosin, troponin, tropomyosin. Also include ATP, myosin ATPase, ADP, Pi, and H* (where important). • Cross-bridge: . Powerstroke: ● Disassociation: ● Reactivation:Can you match the sacromere anatomy with the proper answer from the list below the table graph? Sarcomere Anatomy Description/Reaction Thin Filaments ? Thick Filaments ? A Band ? I Band ? M Line ? H Zone ? Z Disc ? A) G-Actin, F-Actin, Troponin, Tropomyosin B) Myosin C) Bisected by the M Line, this area shows only the thick filaments without any thin filamentous overlap D) The point of origin for myosin filaments found in the center of the sarcomere E) An area in the center of the sarcomere marked by the entire length of the thick filaments F) A space between sarcomeres with the z-disc in the center; this region shows Actin's anchorage points and extension without myosin overlap G) Anchoring point for the thin filaments