You have 300 copies of a DNA sequence. You perform 10 rounds of PCR. How many copies of the DNA sequence will you have? Just write the number. Do not include any commas or blanks.
Q: Introduction: The Impact of Ocean Acidification on Shellfish Calcification The health of the world's…
A: Let's delve deeper into the various aspects of ocean acidification's impact on shellfish…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of the question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: Determine whether the reproductive behavior is evolutionary stable or unstable: Cowbirds are nest…
A: Here's why: Fitness Benefit for Cowbirds: Cowbirds benefit from this behavior by avoiding the costs…
Q: Drag and drop from the available list of terms. The synthesis of complex molecules is reaction,…
A: The building of complex molecules, such as sugars, from simpler ones is an anabolic process and is…
Q: Make a pathophysiology of Upper respiratory tract infection
A: The objective of this question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: Immanuel Kant’s Investigation of the Question Whether the Earth Has Undergone Any Change in Its…
A: The objective of the question is to understand the theory proposed by Immanuel Kant in his work…
Q: +…
A: To determine the base sequences for a silent mutation and a non-silent (or missense) mutation in the…
Q: of the given answers What are the possible sex chromosome combinations for children with the…
A: The question is asking about the possible sex chromosome combinations in children with congenital…
Q: Q 7: What is the function of the nuchal crest? Which species have a pronounced one and what does…
A: Approach to solving the question: Comprehensive analysis provided as per the topic mentioned in the…
Q: How to solve the genotype, allele, and phenotype frequency.
A: The first step is to compute the allele frequencies: Allele frequencies are numerical…
Q: 1/v (sec/μmol) Enzymes A and B catalyze different reactions but use the same reactant molecule as a…
A: The Km and Vmax are two parameters we are looking into if we study enzymes. Therefore, we can use…
Q: Is the variation associated with lactose tolerance found always on one chromosome, bothchromosomes,…
A: The question is asking about the genetic basis of lactose tolerance, specifically where the…
Q: I need help making changes to this essay using these research articles: Wood, H. L., Spicer, J. I.,…
A: The objective of the question is to revise the provided essay using the information from the two…
Q: Describe the progression of cancer from an early benign lesion to a genetically heterogeneous…
A: Cancer, characterized by uncontrolled cell growth and spread, progresses from benign lesions to…
Q: An angiosperm which is unable to form fruits would likely have which of the following defects?…
A: The question is asking about the potential defects that an angiosperm, or flowering plant, would…
Q: This morphologic abnormality of mature granulocytes is most frequently associated with infectious…
A: The question is asking to identify the morphologic abnormality of mature granulocytes that is most…
Q: Identify the three individuals whose investigations led to the banning of the use of…
A: I have provided the answer above for you. See the answer I provided above to understand the given…
Q: THINK ABOUT IT- Look at the food web below and answer the questions. FIGURE 6.3 Food webs: (a) a…
A: Food webs show intricate relationships that sustain life within various ecosystems, showcasing the…
Q: I need help making changes to this essay using these research articles: Wood, H. L., Spicer, J. I.,…
A: The objective of the question is to revise the given essay on the impact of ocean acidification on…
Q: You cross a fruit fly with long wings (L) to one with short wings (l), and out of over 100…
A: Solution:Determining the Genotypes of the ParentsTo determine the genotypes of the parents, we can…
Q: Neanderthals had large brain. True or false
A: The question is asking whether Neanderthals, an extinct species of hominids that were the closest…
Q: What are the characteristics/prominate features of a neanderthal skull?
A: The question is asking about the distinctive features or characteristics that are found in a…
Q: Q13: In your own words, please explain how race is a social construct while ancestry is biological…
A: Q13: The concept of race is more about how societies categorize people based on physical traits,…
Q: Submission Questions A) Explain how the structure of an enzyme makes that enzyme specific? B)…
A: Q. B answerMetabolic pathways can shift in different directions, either reversed or forwarded, based…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of the question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: The following image is a scheme for serial dilutions prepared for spectrophotometric analysis. If…
A: Step 1:Step 2:Step 3:Step 4:Step 5:
Q: that hydrolysis of ADP cell respiration formation of ATP releases is an endergonic process free…
A: Approach to solving the question:Endergonic reaction absorbs free energy (positive change in free…
Q: Which regions of the world have the highest lactose tolerance? Which have the lowest? Where would…
A: The question is asking about the geographical distribution of lactose tolerance and intolerance, the…
Q: Based on the information provided by the Angus pedigree below, Princess Alta of Wey (R) is inbred. T…
A: Inbreeding occurs when an animal's parents are more related than the average individual in the…
Q: I need help with this question please
A: During the G1 phase of the cell cycle, Cyclin-Dependent Kinase (CDK) complexes prepare for the…
Q: Genetics Q4
A: The question is asking us to identify which of the given options has not been successfully cloned as…
Q: Find an occurence where a biomechanical therory or concept was being used in a tv show/advertisement…
A: a) One example of a biomechanical theory being used in a TV show is in an episode of "MythBusters."…
Q: Match the following terms with the best description. Question 6 options: A…
A: The objective of the question is to match the given terms with their correct descriptions.
Q: Why is intelligent design (ID) a flawed argument? Select the statement that is FALSE. There is no…
A: The concept of irreducible complexity in Intelligent Design is misrepresented in this statement.…
Q: Humans have a complex relationship with fresh water and having too much or too little can be deadly.…
A: The objective of the question is to understand how human populations respond to extreme water…
Q: step by step calculations please
A: For the first column:Concentration = 180 ng/ulVolume = 25 - 0.4 ul = 24.6 ulng DNA = 180*24.6 =…
Q: 8. True or False: The person-centered approach focuses on the person’s personal preferences and…
A: The person-centered approach is based on the notion of acknowledging and appreciating each…
Q: make sure it’s correct
A: The sex of turtles is dependent on or determined by the temperature in such a way that warm eggs…
Q: Drag and drop from the available list of terms. are a diverse set of enzyme that catalyze two…
A: Ligase is an enzyme that can catalyze the joining (ligation) of two molecules by forming a new…
Q: Evaluating the positive and negative effects stress has on the body 1. Does stress affect out…
A: Approach to solving the question: To address the question of how stress affects our ability to…
Q: This is intro to neuro
A: Synaptic Integration: The Neuron's Decision-Making ProcessSynaptic integration is the fundamental…
Q: molec
A:
Q: What is the primary focus of quality assurance? Question 6 options: a) To…
A: The primary focus of quality assurance is to ensure that the products or services provided meet…
Q: Experiment The effect of starvation on protein synthesis in Caenorhabditis elegans was studied in…
A: 1. At the top of the gradient the molecules that are detected by UV absorption are small RNA…
Q: When Anne gets infected with smallpox, one of the first symptoms she experiences is a fever. The…
A: The objective of the question is to understand the role of the immune system in response to an…
Q: I need help with this question please
A: The Tubulin-GFP fusion protein is typically used as a fluorescent marker to visualize microtubules…
Q: Black men are more likely to get prostate cancer than other men. You are working on a prostate…
A: The objective of the question is to understand the procedure to isolate prostate cancer cells from…
Q: . Some years ago, the CDC noticed a puzzling trend: Reported cases of salmonellosis seemed to soar…
A: Regarding the seasonal trends in reported cases of salmonellosis, the Centers for Disease Control…
Q: In case of failure of the innate immunity to contain the infection, the body will oppose a more…
A: Approach to solving the question:To address the question about cellular and humoral immunities, it's…
Q: 27 and 28
A: ANSWER : Sure, I can help you with these questions about molds. Question 27: Which of the following…
Genetics Question 4
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Can you please check my answer and make sure it is correct. Question: Describe the two roles primers play in PCR. Answer: Primers are short sequences of single stranded DNA that mark both the ends of the target sequence to be amplified during PCR. One primer attaches to the top strand at one end (forward primer) and the other one attaches to the bottom strand at the other end of the segment (reverse primer). They are made specifically to attach to these sections of DNA because the nucleotides of the primers are complementary to the target sequence. Other than marking the starting and end points for PCR, primers are also necessary for the process because without them, DNA polymerase wouldn’t be able to synthesize the complementary strand of DNA because it can only add nucleotides to an existing piece.1 2 Today's technology has made it easier to quickly and accurately generate DNA profiles. In this part of the activity, you will model the process yourself to solve a crime. Good luck, detective! Crime Report: A thief has stolen a priceless collection of jewels from the Museum of Precious Jewels. Forensic technicians obtained skin cells from a forehead print left on the glass enclosure of the jewel exhibit. DNA has been isolated and PCR amplified for some of the standard STR loci. A partial genetic profile generated from the collected DNA is shown in Figure 5. 10 50 DNA Profile from Forehead Print Number of base pairs 00 50 40 D58818 075830 I 16 MU DES1179 Shandand (10) 70 CSF1PO DITS820 80 100 Figure 5. The DNA profile of the forehead print from the scene of the crime. Each colored line shows the alleles for one of four of the core CODIS STR loci (D5S818, CSF1PO, D7S820, D8S1179). and data for the four STR loci that were included in the A suspect was identified in the case. Her DNA…Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
- After you design the PCR primers, you run the PCR on fluid from the patient’s nasal swab. Next, you need to evaluate the results. PCR makes billions of copies of just one sequence in a sample. Since you know the sequence, you also know the length (number of nucleotides) of the region you copied. There are about 130 nucleotides in the N gene fragment. This is typically stated as 130 base pairs. How can you visualize DNA and estimate its size? Load the DNA sample into an agarose gel (similar in consistency to jello) and apply an electric current to the gel. The DNA is charged and will move through the gel. The longer the DNA fragment, the more slowly it moves. The DNA is visualized by adding a fluorescent dye to your sample that sticks to DNA. When you look at the gel under UV light, the DNA should glow. What is the charge of a DNA molecule? Based on #1, would you expect DNA to be drawn to the (+) or (-) electrode of the gel electrophoresis chamber?What purpose do short DNA primers serve in PCR? O They determine which sequence of DNA is copied O They synthesize new DNA O They synthesize proteins O They separate RNA from DNA MacBook Air 80 888 F7 F6You are performing PCR for the first time using some new primers that are 25 nucleotides in length with an estimated melting temperature of 65 0C to amplify a 200 nucleotide gene. After PCR, you run an agarose gel on the samples and observe a faint band at 25 nucleotides. What is the best possible explanation for the results? The primers hybridized to multiple sites on the DNA template. Too much template DNA was added to the PCR mixture. The primers dimerized preventing DNA transcription from occurring. A nuclease was in the solution causing degradation of the DNA.
- During PCR, the reaction mixture cycles through three temperatures (for example 94, 60, and 72 degrees Celsius) multiple times. What happens during the 94 degree part of a cycle? Group of answer choices Double-stranded DNA denatures and becomes single-stranded. DNA polymerase synthesizes daughter DNA molecules. An oligonucleotide primer anneals to a template DNA strand.Create a script about genetic manipulation on animals and plants. All contents of the video must be original. Thank you, it's for my project.Page < Lab Procedure: The forensic specialist sends you the DNA from the crime scene (CS), and DNA from four different suspects (suspects A, B, C, D). You perform a PCR with each DNA sample. Using primers specific to the DNA sequences on either side of the STR, you amplify billions of copies of each of the two original TH01 alleles in each DNA sample (CS, A, B, C, and D). Then you run an agarose gel (DNA gel electrophoresis), which separates the DNA fragments by size. You obtained the following results (picture of DNA gel): CS A B C D Ladder
- Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be able to amplify this entire DNA fragment. Your answer must fulfill the following criteria: Design the primers so that they are each 7 bases in length. Please write out the sequence of these primers. Don’t forget to indicate the direction (polarity) of both ends of each primer. Note that only the polarity of one end of one of the template strands of DNA is provided below. Describe where the primer would bind (i.e. top or bottom template strand, left or right side of the DNA strand) Organize your response so that each primer, and associated information, is separated by at least one blank lineFor separating DNA of different sizes, you would use Question PCR Questi Gel electrophoresis Restriction enzymes 1 Listen Crispr For making specific DNA changes in living organisms, you would use ** Crispr Restriction enzymes Gel electrophoresis PCR ◄0 Listen You are interested in identifying genes that determine tail length in dachsunds. You analyze the genome of several dachsunds and look for SNPS that correlate with tail length. The results are shown here pog Spot Rover Chase Frisbee Cin Checkers SNP 1 SNP 2 SNP 3 Tail Length (cm) 10 12 SNP 4 9 4 3 10 SNP 1 C C C G C SNP 2 A T T A A T Based on these results which SNP is best correlated with tail length SNP 3 C C C G C SNP 4 G G T T T GYou want to amplify a specific region of DNA during PCR. Your primers should a Both should be an exact replica of the beginning of the specific gene you want to amplify b Both should be complementary to the beginning of the specific gene you want to amplify c One primer should be identical to the beginning of the gene sequence while the other is identical to the end of the gene sequence d One primer should be complementary to the beginning of the gene sequence while the other is complementary to the end of the gene sequence e One primer should be identical to the beginning of the gene sequence while the other is complementary to the end of the gene sequence