Peptide sequence using 1-letter code for amino acids: EDLSMTCFRH What is the net charge of this peptide at pH 9? Use the pKa values from Table 4-1 from Voet, Voet and Pratt. -2 -1 O +1 +2
Q: What are the vitamin derivatives of the following A. Nicotinamide coenzyme B. Flavin coenzyme C.…
A: Vitamins are the organic compounds that are vital for the health of an individual. Vitamins are…
Q: The child who fainted was taken by ambulance to the hospital. Objectively: reflexes are absent,…
A: The following steps will explain how accumulation of a specific metabolite leads to appearance of…
Q: 10 glucose molecules are used in anaerobic respiration. How many ATP will be yielded under these…
A: Cellular respiration occurring when oxygen is absent is known as anaerobic respiration. It is a…
Q: Experiment A. You replace spiperone with a radiolabelled drug that has a higher affinity for the D₂…
A: The log dose-occupancy curve is a graph that shows the relationship between the concentration of a…
Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: what would be the concentration of cholesterol in the blood? Slope of trend line = 0.98 Absorbance…
A: Concentration of any unknown bio-molecule such as proteins, carbohydrates, cholesterol etc can be…
Q: A polar functional group that forms disulfide bridges and stabilizes protein tertiary structure is A…
A: The sequence of amino acids in the polypeptide chain is referred to as the fundamental structure of…
Q: Qualitative Tests for Carbohydrates: Sugar Solution Glucose Sucrose Lactose Hydrolysis: Molisch's…
A: Qualitative tests for carbohydrates are done to confirm the presence of carbohydrates in a sample,…
Q: A man and woman are both carriers for the recessive mutation that causes cystic fibrosis (genotype…
A: The probability that none of the children would have cystic fibrosis (genotype dd) can be calculated…
Q: tate and define the four levels of protein structure, also include the bonds found at each level?
A: Introduction Proteins are the most abundant macromolecules in our body. Proteins are made up of…
Q: A. Briefly discuss the four levels of structure in proteins.
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Identify different types of organic reaction mechanism (SN1, SN2, etc) and reaction types (addition,…
A: SN1 reactions are substitution nucleophilic reactions that occur in a single step. They involve the…
Q: How do you draw different amino acids at ph 7? can you show me an example which I can follow to draw…
A: Amino acids are the building blocks of proteins. They are organic compounds that contain a carboxyl…
Q: 1. The dipole moment in a water molecule Which statement about hydrogen bonds is NOT true? A)…
A: The noncovalent interactions between molecules include electrostatic interaction, hydrogen bonding ,…
Q: 2.4. the second stage of cholesterol synthesis further conversion into cholesterol; formation of…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Part A. Weight of skimmed milk Isolation of Casein Weight of dried casein Percentage casein in…
A: Since you have posted multiple questions, we will provide the solution only to the specified sub…
Q: what is the dna concentration suspended in PO4 buffer at ph 7.0 that has an absorbance at 260 nm…
A: DNA concentration of a sample can be determined using spectrophotometry and measuring the absorbance…
Q: The catalytic mechanism of an enzyme found in the mitochondrial matrix (pH = 7.8) depends on an…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: An enzyme facilitate catalysis by formation of ester bond with an alcoholic substrate. Which amino…
A: Ester bond: The bond that is formed by the condensation of alcohol group with a carboxylic acid…
Q: 2. Biosynthesis of cholesterol in the human body: 2.1. cellular and tissue localization of the…
A: Lipids are a chemically diverse group with two common characteristics: low solubility in water and…
Q: Which of the following correctly matches the building block to the macromolecule it forms? Amino…
A: Introduction There are four different types of macromolecules present in our body. These are…
Q: What chemicals do you think are most harmful to your own health? How are you exposed? How could you…
A: Benzene and other aromatic hydrocarbons, along with heavy metal compounds are one of the the most if…
Q: a. Draw out the pathways described above. Provide accurate line drawings for each lipid described b.…
A:
Q: b) How does oxygen availability determine the fate of the glycolysis pathway?
A: Glycolysis is a central metabolic pathway that is used by all cells for the oxidation of glucose for…
Q: Inhibitors are important in developing new pharmaceuticals. Two important classes of inhibitors…
A: Inhibitors are molecules or compounds that reduce the rate of a chemical reaction, or block it…
Q: 1. What is gluconeogenesis? 2. Explain the biochemical effects underlying the metabolic functions of…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: It is a pyrimidine derivative that does not form part of nucleic acids.... A) Thymine B) Cytosine C)…
A: Nucleotides are the building blocks of nucleic acids. They are phosphoric acid esters of…
Q: 8. A type of gene therapy called RNA interference (RNAI) is being investigated to treat Huntington's…
A: Small interfering RNA (siRNA): This is a type of RNA molecule that can trigger the degradation of a…
Q: 12. Which of the following ligands cannot act as an ambidentate ligand? o nitrite, NO₂ o…
A: Ligand is a molecule which bind reversibly to the protein. A ligand may be any kind of molecule, it…
Q: 10. Briefly describe and draw the structure of these polysaccharides based on glucose or another…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 6. List four (4) organelle structures that are similar for both plant and animal cells. List the…
A: Cell organelles, or simply Organelles, are subunits present in a cell responsible for carrying out…
Q: From the following information determine the amino acid sequence of a peptide. N-terminal Edman…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Write a scheme for the synthesis of mevalonic acid as the first stage of cholesterol synthesis.…
A: Cholesterol is a sterol found in the plasma membrane that has the characteristic steroid nucleus (4…
Q: 4. What is the net charge (approximately) on the polypeptide shown below at pH 12.5? Lys - Arg - Val…
A: Amino acids are the building blocks of proteins. The structure of amino acid consists of a central…
Q: Part Three: Metabolism: Your cells are going to USE the food they've been provided! Describe the…
A: Metabolism is the chemical reactions occurs in our body which changes the food into energy to run…
Q: list the primary energy system out of these 3 (only pick 1) (TP-PC System, Glycolysis & Citric Acid…
A: Food is the composition of carbohydrates, fats and proteins. On digestion these macromolecules are…
Q: ~0.766+ 47425 y-0.568x46576 . . . . . X The inhibitor binds at the active site. The inhibitor binds…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 2. A mutation that changes an alanine residue in the interior of a protein to valine (A157 → V157)…
A: Different protein gain its three dimensional structure after folding, which occurs according to the…
Q: raw the following Lipids in A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Biological waxes are esters of long-chain fatty acids and long hydrocarbon-chain alcohols. They are…
Q: describe the importance of bonding & chemical structure in identifying carbohydrates.
A: Carbohydrates are composed of carbon, hydrogen, and oxygen atoms, and their chemical structure is…
Q: True or False: The side chain of glutamate can form an ionic bond at pH 1. True False
A: Glutamate is an α-amino acid that is commonly found in proteins.The amino acid has a side chain…
Q: ) Describe the 10 enzymatic reactions of glycolysis and the organization of the pathway in 2 main…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. b)…
A: Insulin (release from the beta cells of pancreas) and glucagon (release from the alpha cells of…
Q: Provide other techniques which can be used to characterize DNA extracts. Provide advantages and…
A: DNA extracts characterization is done by many methods. It is done to check purity, stability,…
Q: 1.a)Which statement is correct with respect to eggs? The white of an egg has about equal quantities…
A: Proteins are complex macromolecules that play a central role in the structure and function of all…
Q: Which of the following are the precursors in synthesizing myristic acid? a. 7 malonyl-CoA b. 3…
A: Myristic acid is a common fatty acid. It has 14 carbons. Its molecular formula is CH3(CH2)12COOH. It…
Q: Experimental results describing a protein's amino acid composition are useful for estimating the…
A: Proteins are high molecular weight polymers of amino acid residues linked together via peptide…
Q: 2. In one paragraph, refute or support the statement: "Photosynthesis and oxidative phosphorylation…
A: There are a lot of metabolic processes that essential serve the opposite purposes of each other.…
Q: Explain this krebs cycle
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Different breeds of Korean cattle produce meat with varying amounts of stearic, linoleic and oleic…
A: Fatty acid synthase (FAS) is a large multifunctional enzyme that is responsible for the synthesis of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Thr-Lys-Pro-Ile-Val-Ala-Pro-Met-Glu-Tyr-Gly-Lys Write the sequence using one-letter abbreviations. sequence: TLPIVAPMGYGK Incorrect Estimate the net charge on the peptide at pH 7. charge at pH 7: +1 Estimate the net charge on the peptide at pH 12. charge at pH 12: 0 IncorrectGiven the following Peptide: Q6 *H;N-Phe-Asp-Ala-Arg-Gy-His-Arg-Asp-Glu-His-Tyr-CO 6a. What is the peptide's net charge at pH 2.0, pH 6.0, pH 7.4, and pH 10.2? (show work) 6b. What is the approximate isoelectric point of this peptide?His-Met-Asp-Tyr-Phe-Ser Calculate an approximate pI (isoelectric point) for this peptide. Please use the pKa's listed within Table 3-1 of Lehninger. Show and/or explain all your work; you must be very clear about WHY you use particular pKa's in your calculation.
- peptide Lys-Glu-Trp answer the following questions: Draw the structure of this peptide when all the ionizable groups are fully protonated. How many ionizable groups does this peptide have? Label the pKa for each of the ionizable groups in the structure above. Draw the appropriate titration curve for this peptide on graph paper starting at pH 0 and ending at pH 14. Label the x-axis, y-axis and the pKa Determine the overall net charge of this peptide at each full equivalent point (including 0) where the ionizable group is 100% deprotonated. Determine the pI for this peptide. Determine the average overall net charge of a mixture of this peptide in a solution where pH=8.5.Ala-Arg-Val-His-Asp-Gln Given the polypeptide chain above Estimate the net charge of the polypeptide chain at physiological pH (7.4) and at pH 5.0 . How many peptide bonds are there? What kind of polypeptide is it?Amino acid structure For any ionizable group, indicate the pka value and draw the structure that would be expected at the pH inside the cell (~7.4).
- Protein-4YU4 is given, choose a part of it (containing at least 30 amino acid residues), find the amino acid sequence (sequence in it), identify what functional groups the amino acid substitutes contain (carboxyl group and 2-position the Nitro group will form amide bonds, forming the covalent basic structure of the protein). What different interactions can occur between these functional groups? How will it relate to the spatial structure of the protein?Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 15 Residue Number ILYYAGSREDHSGYLIL EQSDTERNQHGALIYLI LIFLAIFPAGSTSEDRR RAFLILFMTYFLILFLI LHGDQNRERDGHSQERD 2 Hydropathy value 0 -4 -2A. Write the structure of the following peptide at pH 5.0 and calculate its net charge at this pH. Asp-His-Tyr-Arg-Lys-Leu-Thr-Gln. Based on the pKa value of the ionizable groups. B. A polypeptide consisting only of L-glutamate residues (poly-L-glutamate) may have a random coil or helical structure depending on pH. Explain this behavior by indicating at what pH values the helical structure will be favored.
- Which of the peptide sequences below best matches the hydropathy plot shown? L 10 Residue Number 4 2 Hydropathy value -2 0 セー RAFLILFMTYFLILFLI ILYYAGSREDHSGYLIL OLHGDQNRERDGHSQERD EQSDTERNQHGALIYLI 01 5 15Determine the net charge (to the nearest integer) on the following peptide at pH 5 AND pH 12. Estimate the isoelectric point (pl) for this peptide: H2N-Leu-Gly-Lys-Glu-COOH Assume the pK,s for functional groups are: alpha-amino 6. alpha-carboxy sidechain-amino (Lys) 10.5 sidechain-carboxy (Glu) 4.2 O Net charge at pH 5 and 12 is 0 and -2, respectively, pl =6.6 O Net charge at pH 5 and 12 is 0 and -2, respectively, pl =3.1 O Net charge at plH 5 and 12 is +2 and -1, respectively, pl =7.5 O Nct charge at pH 5 and 12 is +1 and -1. respectively,. pl -4.5 2.0ミレーNレ NH geometry on both cand N. Torigonal plannes CH - C-N o=), HN CH2 CH-C-OH (a- carbon) CH2 HooC Aspaxagine - Toline - Valine - Arginine - phenylalcmine - Glutamic ocid. 1.Give the name and three letter code for each amino acid in the peptide. e 2. At pH 7, approximately what charge would be on your peptide? Explain your answer. 3. Can your peptide form intra/interchain disulfide bonds? Explain why/why not. e 4. Will your peptide absorb UV and is it fluorescent? Explain why/why not. e 5. What is the probability that your peptide contains a cis peptide bond? Explain your answer.