How many calories are in 7101 J? (1 cal = 4.184 J)
Q: Q1B: Calculate the number of wear particles produced per year, assuming spherical UHMWPE particles…
A: Total hip replacement (THA), commonly known as total hip arthroplasty (THA), is one of the most…
Q: Use the gel image below to determine the sequence of the original DNA template strand sequenced…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: Elongation of fatty acids chains beyond 16 carbons takes place: on the membrane of the endoplasmic…
A: Acetyl CoA from glucose oxidation or other anaplerotic reactions is produced in mitochondria and…
Q: You run an SDS-PAGE gel on some purified protein samples against a protein ladder as marked. kDa 225…
A: SDS PAGE is an electrophoretic technique, which is used to separate proteins based on their size.…
Q: Which of the following results are most likely to be observed in liver enzymes following initiation…
A: When subjected to a prolonged period of starvation, the level of glucose in the blood falls. This…
Q: 9. PFS in erythrocytes, its biological significance, manifestations and consequences of…
A: Progression-free survival (PFS): It is "the amount of time a patient experiences the diseases but…
Q: Choose the best answers for each missing word from the list below. (1)__________ is a first…
A: Biochemical cell signalling is the method by which cell communicates with each other cells and…
Q: true/ false: When proteins are denatured 1°, 2°, 3°, and 4° structure is lost.
A: Denaturation is a process in which proteins lose their original structure or confirmation. The loss…
Q: Identify the type of base and sugar group present in each nucleotide or nucleoside. HO. H₂C -CH₂ ОН…
A: A nucleotide consists of a base, a molecule of sugar and one of phosphoric acid. The sugar can be…
Q: Calculate the volumes of the 100 mM PNPP stock solution and buffer (final volume of 1.00 ml) needed…
A: Molarity is way of representing the concentration of a solution. Molarity is the number of moles of…
Q: Consider the following pairs of fatty acids and underline the fatty acid in each pair that will have…
A: Fatty acids are very important class of macromolecules in our body. They are the simplest type of…
Q: what are correct about enzyme kinetic parameters
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…
Q: name the reaction of the carbohydrate catabolism
A: The catabolism of carbohydrates is a series of redox reactions that produce energy from…
Q: Explain how an enzyme could distinguish between the (now circled) equivalent positions in the above…
A: Aconitase is an enzyme that catalyses the conversion of Citrate to isocitrate. Aconitase is an iron…
Q: Describe two reasons why the reaction glutamine synthetase performs is important to the body.
A: Cells can accumulate nitrogen in the form of ammonia from amino acid degradation, photorespiration…
Q: The patient has mechanical jaundice. Will it affect the absorption of fat-soluble vitamins? There…
A: To live a healthy and active life, humans need a variety of nutrients. Good nutrition, or the…
Q: The hormone interacts with the metabotropic receptor, as a result of further implementation of the…
A: The G protein is a protein found associated with G protein-coupled receptors. The receptor coupled…
Q: Label the parts of the below lipid molecule. Is this a saturated or unsaturated lipid? H H I-U-I H…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: The purpose of DNA gyrase in replication is: to relieve positive supercoiling induced by unwinding…
A: Introduction: The process of DNA replication involves the production of an exact copy of genetic…
Q: In the presence of O₂ and low energy status of the cell, acetyl CoA is oxidized to oxygen O lactate…
A: Acetyl Co A is a two carbon and an important biochemical molecule which is a connecting link of…
Q: Saturated fatty acids are degraded by the stepwise reactions of oxidation, producing acetyl-CoA.…
A: Simple fats or triglycerides or triacylglycerides are categorized as storage lipids. Triglycerides…
Q: Draw the structure of alanylserine, a dipeptide made from alanine and serine, as it would appear at…
A: A dipeptide has two amino acid residues. Amino acid sequences are written with N-terminal amino…
Q: Finally, using the formula to convert between standard states, show that that your calculated values…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: Glucose and fructose are both C6H12O6. What is the structural difference between them? Glucose is a…
A: carbohydrates are carbon molecules which undergo oxidation to yield energy. Carbohydrates are…
Q: ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled…
A: The free energy changes in chemical reactions are denoted by ΔG. ∆G = ∆H − T∆S where ∆H is the…
Q: Which of the following is 18:248,11?
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: a) You evaluate the lipoxygenase inhibition by different concentrations of octyl protocathechuate.…
A: Inhibitors are the substances that bind to enzymes to regulate their activity . There are…
Q: true/false: Transamination reactions yield an a-keto acid and an amino acid.
A: The amino acids undergo reactions like transamination and deamination. As the name suggests the…
Q: Compare and contrast biochemical pathways. Describe the chemistry of the last three steps of the…
A: The citric acid cycle involves the oxidation of acetyl-CoA into CO2 and H2O. The beta-oxidation is…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are bio molecules that are made up of fatty acids and glycerol. They are insoluble in water…
Q: Describe the four levels of protein in great depth. Desrcibe how protein structure may affect…
A: Proteins are biomolecules composed of amino acids. Amino acids are joined together through peptide…
Q: Classify each metabolic reaction as an oxidation-reduction reaction, isomerization reaction, or…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: 2. What is the terms used to describe what is happening to the members of the electron transport…
A: The electron transport system (ETC) is the series of redox reaction in which involved a series of…
Q: Glycogenesis occurs in both muscle and liver. Select one: O True O False Glycogen is released from…
A: Glycogen is storage-type homopolysaccharide that contain two types of glucose polymers: amylose:…
Q: The structure of a metalloenzyme active site is down below(black picture). Describe, from a chemical…
A: Methane monooxygenase (MMO) is present in methanotrophic bacteria and MMO is present in an integral…
Q: A buildup in the levels of acety-CoA would result in the inhibition of what reaction in…
A: Fatty acid β-oxidation is the process of breaking down a long-chain acyl-CoA molecule to acetyl-CoA.…
Q: Assume that you are conducting a chain-addition polymerization using 5.47 grams of monomer (MW=…
A: The number of moles is given by the ratio of the given mass in grams to the molar mass(MW) No. of…
Q: calculate the [PNP] in μM for each of these samples.
A: Molarity is way of representing the concentration of a solution. Molarity is number of moles of…
Q: Name the enzymes that catalyse (a) substrate-level phosphorylation and (b) coupled reactions during…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: * 15-14 AG AG is +6.64 kJ/mole +1.59 kcal/mole for the reaction Citrate - = Isocitrate. is -267…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: The oxidized form of NADH is O NADH+ O NAD+ O NADOH O NADH2 -
A: Metabolism involves the use of many redox reactions. In redox reactions, electrons can either reduce…
Q: Metabolism is best defined as a collection of Ocellular processes that activate cell division.…
A: Biochemistry is an attempt at explaining the living cell in chemical terms. A living cell is the…
Q: 1) Find the pH of 0.1 M of the differnet forms histidine species. (See image for equation and pKa…
A: Amino acids are building blocks of the proteins. Alpha carbon of amino acids consist of carboxyl…
Q: Fill out the last column of this table: Component 1X concentration 20X (Provide unit)
A: The dilution factor tells us how much of the original stock solution is present in the final…
Q: A cyclic AMP (CAMP) binding protein was isolated from mammalian cells and characterized by…
A: Given that,The ligand is cAMPThe receptor is cAMP binding protein (CBP)also the concentration of CBP…
Q: In order to break the carbon-carbon bond of Acetyl-CoA in a way that does not harm the cell, citrate…
A: Glycolysis is the metabolic pathway by which 6-carbon glucose is converted into 3-carbon pyruvate in…
Q: 3. Attach the structures below to draw a sphingolipid. CH3-(CH2) 12-CH=CH-CH-OH sphingosine CHINH,…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: 15-24 b) c) Identify the molecules oxidized and reduced in the following reactions: a) CH₂CH₂CHO +…
A: Many redox reactions occur during metabolism. Redox reactions necessitate the transfer or removal of…
Q: Describe the structural similarities and differences of the following pairs. Identify which of these…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Compare and contrast endocrine and exocrine glands.Andree is a 25-year-old powerlifter. He weighs 235 lbs and is 6 ft 1in tall. His average day includes 90 min weight lifting at a MET of 6. He does HIIT workouts 3x/week for 30 minutes at a MET of 8. TDEE with TEA including both workouts: 2900 kcals + (961 kcals) + (427) - (213 kcals) = 4075 kcals Analyze his macronutrient needs. Determine the percentage ranges and g/kg ranges for protein and carbs. Determine the percentage range for fats. Prioritize carbohydrates and protein and determine the kcals of each. Determining remaining fat intake and double-check the percentage is within a healthy range. Final Protein g, kcals,%: Final Carbohydrate g, kcals, %: Final Fat g, kcals, %:Greg Tobin mixes together three types of vitamintablets. Each Super Vim tablet contains, among other things,15 mg of niacin and 12 I.U. of vitamin E. The figures for aMultitab tablet are 20 mg and 15 I.U., and for a Mighty Mix are25 mg and 35 I.U. How many of each tablet are there if the totalnumber of tablets, total amount of niacin, and total amount ofvitamin E are as follows?a. 225 tablets, 4750 mg of niacin, and 5225 I.U. of vitamin Eb. 185 tablets, 3625 mg of niacin, and 3750 I.U. of vitamin Ec. 230 tablets, 4450 mg of niacin, and 4210 I.U. of vitamin E
- hiii please help me understand this activity. thanksWhich of the following fasting blood glucose results would be considered normal? 76 mg/dl 126 mg/dl 54 mg/dl 102 mg/dl[Glucose Phosphate] 45 35 25 15 5 Glucose-phosphate production at four blood sugar levels 10 [0.25] and [0.40] [0.10] units. [0.05] 90 50 Time in seconds Glucose-phosphate production by an enzyme extracted from cells taken from the much-feared Lilyputin in media with four different glucose levels is provided above. The fasting blood sugar levels of this animal fall between 0.40 and 0.60 sugar units. The enzyme catalyzing this reaction must be enzyme was extracted could have been cells (enter one of these choices). The Km of this enzyme to three decimal places is and the cells from which the muscle cells /pancreatic beta Enter only a number, no
- adentVUE B Table of Contents x B Homepage-2022 X DeltaMal IpQLScizmoeop5-4WA3yY20Vic8quirEip1r7NLKxf_bQYVnQYcjA/viewform protein Which of the follow diets would be appropriate for cross country hiker? * O high glycerol and fatty acid intake O high amino acid intake O high polysaccharides like glycogen O high polypeptides like glycogen Which of the following is a polymer of a carbohydrate? * polypeptide amino acid O phospholipid polysaccharideplshelpp..Calculate the TEF (in kcal/day) of a 2,678 kilocalorie daily diet. (show work)
- Please show computation for calories and cal/gmGlucose Insuln 45 60 75 90 105 120 135 150 15 Time/minutes 75g glucose given Concentration of substance in bloodHi there! I need help. I am extrmely confused and cannot figure out how to solve it correctly. Question: How many milligrams are needed to make 100 mL's of a 100 microMolarity insulin solution? Given a 10 mg/L solution of insulin, what is its concentration in microMolarity? Thank you for any help! I cannot seem to figure this out.