HbA1c is used to monitor blood glucose levels because hemoglobin is the only protein in blood that is covalently modified by glucose. True False
Q: Please identify whether the statements below is true or false. Thank you! (Please put a short…
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. Proteins are polymers…
Q: но но- но он HN. он O Cerebroside O Sphingosine O Ganglioside O Ceramide
A: Cerebrosides are lipid complex , present in the sheaths of nerve fibers. Sphingosine forms a primary…
Q: During the treatment of hyperlipidemia, what is the metabolism of lipoproteins; and the mechanism of…
A: Hyperlipidemia refers to a high-level blood lipids like cholesterol (non-HDL cholesterol and LDL…
Q: Which of the following contain copper atoms (Cu2*) Select one: O a. Complex II O b. Complex III…
A: There are four enzyme complexes of ETC present in the inner mitochondrial membrane. Complex 1-…
Q: pyruvate in the glycolytic pathway build up slowing the pathway. Which of the following products may…
A: RBCs carry oxygen from the lungs to the rest of the body's cells. This oxygen is needed to generate…
Q: Which substrate is used in the last step of glycolysis? Group of answer choices Glyceraldehyde…
A:
Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…
A: The Molisch's test, Fehling's test, and Bial's test are the qualitative tests for carbohydrates. In…
Q: Describe the roles of calcium in the cell, and the mechanisms that the cell uses to control…
A: Calcium is a vital nutrient that aids in the mineralization of the skeleton. Over 99 percent of the…
Q: The parasite Trypanosoma brucei, which causes sleeping sickness, uses proline as an energy source…
A: A transport mechanism that works to facilitate the movement of substances in and out of the cell…
Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…
A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: In plants, under what solution conditions are Calvin cycle and gluconeogenesis enzymes most active?…
A: Gluconeogenesis is the process of Synthesis of glucose from non Carbohydrate sources like aminoacids…
Q: 1-How is a total cholesterol test different from a lipid panel?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: You are required to isolate, purify and verify the purity of an enzyme from cytosol of a plant
A: Enzymes are usually composed of proteins which is specific for its substrate. It has immense…
Q: The purpose of the carbohydrate in the food industry and its frequency of use
A: A carbohydrate is a biomolecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms, with a…
Q: Explain which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: What might be the dangers in using supplements to get DHA in your diet?
A: Docosahexaenoic acid (DHA) is an omega-3 fatty acid found in cold-water fish like tuna and salmon,…
Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot…
A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…
Q: Second messenger in regulation of metabolism is: Select one: O a. hormones Оb. АТР neurotransmitters…
A: Secondary Messengers are the molecules that act as amplifying components in the cell signalling and…
Q: Introduction to urinary proteins and CSF proteins.
A: Protein is a highly complex molecule found in all living things. Proteins were identified as…
Q: The reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase involves two "sub-reactions", one…
A: A mole of NAD is reduced to NADH by glyceraldehyde phosphate dehydrogenase, resulting in…
Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…
A: Given P1(Parent 1)= Round Shape(T) Yellow Colour (Y) P2(Parent 2)= Wrinkled Shape(t) Green Colour…
Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…
A: The qPCR is generally useful to determine the actual value of PCR product present at provided…
Q: Hello! Can you help me in determining the statements below if it's true or false? It's all about…
A: Lipids are organic compounds that are insoluble in water and soluble in organic solvents like ether…
Q: 1. Foods cannot be compared without determining the “per gram" values. Explain the reasoning behind…
A: Nutrients are substances required by the body, for the growth and development, reproduction, and to…
Q: a) Give an appraisal of prokaryote cell lines as recombinant polypeptide expression systems. (b)…
A: The bacterial expression system is widely used for the recombinant expression of mammalian proteins.…
Q: what transport proteins are involved is getting ca2+ out of cytosol
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: What kind of quality assessment is performed on amylase and why is this important? 2. What are the…
A: Amylase comes under the glycoside hydrolase enzyme family that break down starch into glucose…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…
Q: Look at tho structuros of tho blood group dotorminante. Red blood cell N-Acetyl- D-glucosamine Blood…
A: Blood group antigens are O-glycoproteins, N-glycoproteins, and glycolipids that are present on the…
Q: Please explain where you would find glycosaminoglycans and what is the importance of these…
A: GAGs are negatively charged linear polysaccharides that are frequently found conjugated with…
Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…
A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…
Q: Question 3 Aldosterone regulates sodium, potassium, and chloride ions in tissues True False
A: Aldosterone is a hormone which is secreted by the adrenal glands. Aldosterone secretion is increase…
Q: 1 Suppose that you have 1ml of a buffer solution with a pH of 6.8 and you add 1ml of 2% starch…
A: Salivary amylase is an enzyme that works on catalytic digestion of starch. Salivary amylase…
Q: 1. What are the major functions of lipids?
A: Introduction: Lipids are a heterogeneous group of biological compounds which includes fats, oils,…
Q: 7. The standard free-energy change (in terms of net ATP production) when glucose is converted to 6…
A: All living organism except extremophiles metabolize carbohydrate particularly Glucose to meet up the…
Q: Match the non-Mendelian genetic terms with their descriptor. Genetic and environmental factors…
A: Genetic and environmental factors collectively influence a phenotypic expression Answer-…
Q: Using specific examples, compare and contrast G-protein coupled receptors and nuclear receptors with…
A: The binding of signaling molecules to specific receptors and production of a cellular response…
Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…
A: 1. The first molecule in the biosynthesis of steroids that contain the…
Q: Which of the following is the primary method by which cyclin proteins are regulated to influence…
A: A. Transcriptional upregulation and translation followed by targeted ubiquitin-mediated degradation…
Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\
A: Retention factor The amount which each component of a mixture travels can be easily quantified using…
Q: Gold nanoparticles are applied in cancer therapy; approaches such as photothermal therapy as well as…
A: Photothermal therapy is the process of using electro magnetic radiation for treatment of cancer.…
Q: A physician diagnoses an infant patient with a pyruvate carboxylase deficiency in part by measuring…
A: In case of Pyruvate Carboxylase deficiency, body accumulates lactic acid in blood. This is an…
Q: How many ATP molecules are produced when 6 molecules of glucose enter glycolysis?
A: Glycolysis is a catabolic pathway in which six Carbon Glucose is catabolised into two 2carbon…
Q: In electron transport c Select one: О a. 1 АТР O b. 2ATP Ос. ЗАТР O d. None of the abe
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: Q1. (a) Describe and illustrate each of the following immunoprecipitation techniques (i)…
A: a) Immunoprecipitation (IP) refers to the small-scale affinity purification of antigens with the…
Q: explain why the protein binding of the drug is not correlated with the distribution or elimination…
A: Many drugs form drug macromolecule complexes by interacting with plasma, tissue proteins, or other…
Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…
A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.
Q: How should you prepare your running buffer?
A: SDS-PAGE is method of separation of protein based on its size. Running buffer of the SDS-PAGE…
Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…
A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…
-
HbA1c is used to monitor blood glucose levels because hemoglobin is the only protein in blood that is covalently modified by glucose.
True
False
-
Insulin Glargine is a long-acting form of insulin that is synthesized with several D-amino acids that slow its proteolytic degradation and extend the half-life of the insulin Glargine molecule.
True
False
-
Step by step
Solved in 2 steps
- Select all that is correct. 1) C-peptide is not present in mature insulin. 2) The insulin produced by rDNA technology has C-peptide. 3) The pro-insulin has C-peptide. 4) A-peptide and B-peptide of insulin are interconnected by disulphide bridges.Novolog differs from "normal" insulin in that: Select one: a. An aspartic acid has been substituted for proline at B28 b. The proline at B28 and the lysine at B29 have been reversed c. A glycine has been substituten in at A21, and two new arginines have been added as B31 and B32 d. A "C-peptide" chain has been added e. The usual insulin molecule has been combined with zinc isophaneWhy is there a distinction of c2c12 cells with and without insulin?
- The Gq-protein and phospholipase C pathway are responsible for stimulating gluconeogenesis and glycogenolysis. What effect would an agonist or an antagonist have on gluconeogenesis and glycogenolysis?Describe one mechanism that leads to continued gluconeogenesis in the liver of T1DM patients, despite already high levels of glucose in the bloodstream.Explain using 2-3 sentences the biological significance of the following peptides . Glucagon Insulin Glutathione Ceruloplasmin Oxytocin
- Which of the following is an expected effect of HIF-1 regulated release of VEGF? Group of answer choices decreased reliance on oxygen for ATP production increased blood supply to hypoxic regions of tissues increased lactate production increased ATP production by oxidative phosphorylation Which of these is LEAST likely to be present at higher levels as a result of stabilization of HIF-1? Group of answer choices citrate hexokinase lactate dehydrogenase pyruvate dehydrogenase kinaseInsulin resistance, as occurs in type 2 diabetes, may lead to increased ketone production and release into blood. Describe the biochemistry that links insulin resistance and ketone production. Compare the cellular energy (e.g. ATP) required and produced when glycogen is synthesize and hydrolyzed, respectively. Compare and contrast the mechanism of fatty acid synthase with translation. When young rats are placed on a totally fat acid free diet, they grow poorly, develop a scaly dermatitis, lose hair, and soon die these symptoms that can be prevented if plant material is included in the diet. Why?An individu with chronic hypoglycemia was suspected of having a defect in one of the enzymes unique to gluconeogenesis. To identify the defective enzyme, tissue samples from a normal liver were compared to samples from the patient's liver biopsy, using a biochemical assay that measures glucose production from glycerol or malate. It was found that incubation with glycerol produced normal amounts of glucose in both the control and biopsied liver samples; however, incubation with malate did not lead to glucose production in the liver biopsy, even though it did lead to glucose production in the control liver sample. Based on these observations, which of the 4 unique gluconeogenesis enzymes is most likely defective in the individual? Consider each enzyme and explain your choice, including why you ruled out enzymes that you did not choose. To answer this question, review how glycerol enters gluconeogenesis (figure 9.48) and how citrate cycle metabolites are transported in and out of the…
- The activated form of glucose that serves as glucose donor for glycogen synthesis is formed by the reaction of UTP and glucose 6-phosphate. True FalseIn acute lymphoblastic leukemia, the cancerous white blood cells typically lack the enzyme asparagine synthetase. Why is the administration of asparaginase an eff ective therapy for this type of cancer?Discuss the mechanism of action of insulin in maintaining the homeostasis of blood sugar in a normal human body.