a) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? c) Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.
Q: Studies of a specific enzyme activity showed that the time the enzyme activity before complete…
A: An organic substance called an enzyme acts as a catalyst for a biological reaction. Each cell in the…
Q: how many hydrogen can be formed from the question above
A: Hydrogen bond is a non-covalent bond that is formed between the hydrogen atom in a molecular dipole…
Q: Create your OWN diagram to show the lock-and-key theory of enzyme activity.
A: There are two theories describing enzyme activity. They are: 1) Lock and Key Theory and 2) Induced…
Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…
A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…
Q: The PI of protein P is 7.3. One can purify protein P by:
A: The proteins are composed of twenty naturally occurring amino acids that are linked vis peptide…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone that regulates blood glucose in levels in the body. It decreases the…
Q: Use the table below to answer the question being asked: Protein Ovalbumin Insulin Fibrinogen…
A: Sodium Do-decylSulphate PolyAcrylamide Gel Electrophoresis (SDS PAGE) is a method used to separate…
Q: b) It's said that secondary structures form because of intra- and intermolecular hydrogen bonding…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: The following are importance of carbohydrates EXCEPT: O carbohydrates are non-polar molecules O…
A: Carbohydrates are polyhydroxy aldehydes or ketones. Depending on their size, they can be…
Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: What is an example of RNA editing? Changing a valine codon to a stop codon Methylation of cytosine…
A: Nucleic acids like DNA and RNA can be edited in various ways. Editing is done for various reasons…
Q: Dehydrogenase reactions in TCA cycle
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: What is the isoelectric point of the peptide LIKES? Show your work below.
A: This peptide is composed of leucine, isoleucine, lysine, glutamic acid, and serine. This peptide…
Q: A Biuret test is a chemical test used to determine the presence of a peptide bond in a substance.…
A: The biuret test detects the presence of proteins in a sample solution. The copper ions in the biuret…
Q: A reaction has a Gibbs free energy change (AG) of +5.3 kcal/mol. Indicate whether each of the…
A: Introduction The Gibbs free energy of a system means the amount of usable energy. The change in…
Q: What is the charge on the following peptide at standard biochemical pH? S-Y-D-F-K-I-V-F-L-L +2 -1 O…
A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…
Q: QUESTIONS: 1. Aside from carbohydrates, lipids and proteins, what other organic compounds are found…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: (Multiple coenzymes on the left may match to the same reaction on the right. Some reactions on the…
A: Co enzymes are the molecules that help in accelerating the reaction rate or helping the enzyme to…
Q: What is the property/characteristics of DNA that makes it insoluble to ethanol/isopropyl alcohol?
A: The mechanical separation of the nuclear contents from the remainder of the cell, accomplished by…
Q: For the following scenarios, determine whether the molecules in the scenario are moving by simple…
A: Biological membranes are structures that surround the cell or organelles and act as barriers. An…
Q: The following are true of the mitochondrial structure I. The inner mitochondrial membrane is…
A: Mitochondria are power house of cell, known to synthesize ATP. They are membrane bound organelles…
Q: A. Given the 7 proteins in the table, will they all be separated properly using isoelectric…
A: Proteins are high molecular weight biomolecules made up amino acid residues linked via a peptide…
Q: How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate:…
A: Glycolysis is a process of breakdown of glucose to 2 molecules of pyruvate. This process also forms…
Q: Provide the principle of each test used to detect the following substances. 17. RNA: 18.…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Which of the following statements about protein folding is incorrect? Select all. GroEL/GroES allow…
A: The proteins fold into their proper three dimensional structure in order to be biologically active.…
Q: To get all of the amino acids out of the oligopeptide below and into the bloodstream through the…
A: Oligopeptide: Any of the enzymes in the family of proteolytic enzymes, commonly known as proteases,…
Q: During anaerobic conditions, lactate travels from the muscle to the liver via the bloodstream. What…
A: The Tricarboxylic acid(TCA) cycle is inactive under anaerobic conditions, thereby the process of…
Q: All enzymes have an optimal temperature and pH environment. Choose how the following changes might…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: True statements regarding the TCA cycle EXCEPT Its metabolic product is ATP. It produces…
A: Citric acid cycle also known as kreb cycle or tricarboxylic acid cycle (TCA). This cycle occurs in…
Q: 4) a) Draw the peptide ASYTL at pH 7 and 12. b) Draw a Titration Curve for this peptide. c) If this…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Which one of the following is found at the 5' end of eukaryotic mRNA?
A: Transcription is the process by which the genetic information stored in the DNA is copied onto a…
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown…
A: Inhibitors inhibits the enzyme activity. There are three types of inhibitors-Competitive,…
Q: In a hydrogen fuel cell, hydrogen gas and oxygen gas are combined to form water. Write the balanced…
A: Water molecule is a compound formed from hydrogen and oxygen gas. It has two Hydrogen atoms and one…
Q: 4. A single base addition and a single base deletion approximately 15 bases apart in the mRNA…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: How many of the following statements are true? Allosteric enzymes display sigmoidal kinetics for…
A: Allosteric enzymes are enzymes that possess additional binding sites known as allosteric sites.…
Q: List the possible interactions in proteins that would affect ∆G.
A: The proteins must fold into its proper three dimensional structure in order to gain biological…
Q: WHAT I CAN DO Activity 6: I learned something? Procedure: In your own understanding answer the…
A: Anaerobic A-lactic energy system: A third system generates ATP at a very high rate when quick,…
Q: . Explain the assembly of an RNA Pol II basal transcription initiation complex.
A: Transcription is the synthesis of RNA from DNA that is the process of copying the information of a…
Q: why is having a more reductive environment will alter the functional characteristics of alpha…
A: Keratin is a protein that is of two types: alpha and beta keratin. Alpha keratin is alpha helix…
Q: Which of the following amino acids has a side chain that can interact with the side chain of F…
A: The structure of the proteins is stabilized by the various covalent and non-covalent interactions.…
Q: molecule with a hydrophilic end and a hydrophobic end
A: Molecules with a hydrophobic and hydrophilic end are known as amphipathic molecules. Such molecules…
Q: Explain IN DETAIL the reactions and processes of alcoholic and lactic acid fermentation. Include…
A: The process of cellular respiration leads to catabolism of pyruvate after the glycolytic pathway.The…
Q: Starch 1/2 English Muffin Fruit1 medium orange Milk 1 cup low-fat milk - Starch 1/2 c. Corn Protein-…
A: INTRODUCTION : Carbohydrates - Carbohydrates, or carbs(short name), are sugar molecules. Along with…
Q: Noncompetitive Inhibitors You can think of noncompetitive inhibition as a combination of both…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: ● What are the three things we need to know in order to begin to understand the way an active site…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. The substrate binds…
Q: 1.0 E oxygen saturation (Y) 0.6 0.4 0.2 0.0 20 40 60 blood pO₂ (torr) 80 100 120 for this picture…
A: Hemoglobin carries oxygen from the lungs to the tissues and CO2 from the tissues to the lungs. When…
Q: What compound of phosphorus is found in nucleic acids? What are the products of hydrolysis in RNA…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: In the figure below, Km is indicated at position labeled B Initial velocity (μM product/s) 50 45 40…
A: Km is Michaelis menton constant that corresponds to the substrate concentration at half maximal…
Q: Why might the compound shown below act as a transition state analog of phosphoglucose isomerase? A…
A: Phosphoglucose isomerase (PGI) is an enzyme belongs to class of isomerase enzyme which catalyzes…
Step by step
Solved in 5 steps
- For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidThe DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'Determine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case “i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AGG GAA TGC СTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC CCA Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC CAA This is the strand with the SNP. (The change is shown in red.) AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TAG TAT CGC TGG GCC САА Suppose a different single-nucleotide…
- Determine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case "i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AĞG GAA TGC CTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC ССАFor each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which it codes. Consult the codon table as needed. 5'-AUU-3' anticodon: 3'- -5' amino acid: 5' -UCU-3' anticodon: 3'- -5' amino acid: 5' -CAG-3' anticodon: 3'- -5' amino acid:c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GUsing the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, GlycineUse the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First Position
- The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineList all single base substitutions that would change a codon for Leu to a nonsense codon. For each, indicate whether it would be a transition or transversion. Second base A UGU Туг Cys UGC C UAU UUU Phe UUC UCU UAC UCC Ser UCA UUA Leu UUG UAA Stop UGA Stop A UAG Stop UGG Trp G UCG CGU CCU CCC CUU CUC CUA CAU His CAC Pro CAA Gln CAG Leu CCA CG CGC Arg CGA 2CUG CGG E AUU AGU Ser AGC ACU AAU Asn AAC Thr AAA Lys AAG AUC Ile ACC A. AUA AUG Met ACG AGA Arg AGG ACA G GUU GCU GCC GUC Val GCA GUA GUG GGU GAU Asp GAC Ala GGC Gly GGA GAA Glu GAG GCG GGG UCAG Third baseListed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.