11. Given your knowledge on mutations and proteins, develop hypotheses to explain how the changes in a rock pocket mouse's Mc1r protein's amino acid sequence might affect its function.
Q: Genetics Q4
A: The objective of the question is to predict the normal function of the dominant allele in yeast…
Q: Look at the figure below. What, if anything can one conclude, and with what level ofconfidence, from…
A: The objective of the question is to interpret the results of a serologic assay for COVID-19 patients…
Q: How can host speciation impact parasite speciation? What are the potential outcomes for parasites?
A: An organism is considered a parasite if it feeds on or inhabits another creature (the host) in order…
Q: what are the parental genotypes of the orange male and the tortoiseshell female cat
A: In cats, coat color is a genetically complex trait that is determined by multiple genes, including…
Q: 1. You want to map the relative location and distance between three genes, GX, GY and GZ. You know…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: What does this figure from the bee paper show? a) Different bees are active at different times of…
A: The objective of the question is to interpret the data and figure provided from a research paper on…
Q: Below is a graphical representation of a survey plot from each island, where icons represents…
A: Alpha Diversity:Addresses species diversity in a particular biological system.It shows the number of…
Q: In the movie on rock pocket mice, what did the team discover about black colouration? Select the ONE…
A: The question is asking about the discovery made by a team of researchers in a movie about rock…
Q: In the "Suburban Landscape" video, Andres Duany states that "suburbia disaggregates the elements of…
A: Urban planning and the development of living spaces have advanced altogether over time, with…
Q: A dessert chef with a staphylococcal skin infection contaminates his whipped cream with bacteria. In…
A: This scenario investigated bacterial growth in contaminated whipped cream. The initial bacterial…
Q: In and out M 3. What are restriction enzymes used for in nature? are used by backsta ta bock ria to…
A: The objective of the question is to understand the role of restriction enzymes, the significance of…
Q: Which of the following are mechanisms to prevent food from entering the larynx? (Check all that…
A: The objective of the question is to identify the mechanisms that prevent food from entering the…
Q: The “mean-speed theorem” for finding average velocity under constant acceleration, proposed by the…
A: The objective of the question is to identify the correct algebraic expression for the 'mean-speed…
Q: Match the following solutions to examples that address problems for biodiversity.…
A: Haida Gwaii Watchmen - listen to local people's perspectives.The Haida Gwaii Watchmen program is an…
Q: Strato of Lampsacus, a student of Theophrastus in Aristotle’s Lyceum, made which of the following…
A: The question is asking about the contradiction made by Strato of Lampsacus, a student of…
Q: How did the observable colonies on each agar plate differ in size, color, and morphology for each of…
A: Size:The size of microbial colonies can vary widely depending on several factors:Growth rate: Some…
Q: Calculate the 2 possible values of x in this equation: x2 – 16x + 48 = 0, either by using the…
A: The objective of this question is to find the two possible values of x in the given quadratic…
Q: For this problem, use the information given in problem 14. A young woman with blood type O gave…
A: • Should the man be the father of the child?Yes, this man is a daddy. The blood type O is recessive,…
Q: Question: (True or False) Given: Eukaryotic chromosomes initiate replication from multiple origins…
A: FALSEExplanation:Detailed explanation: Eukaryotic chromosomes initiate replication from multiple…
Q: 3:09 1 Back Pulse Question 31 (Mandatory) Which condition causes breathing rate to increase? a)…
A: QUESTION 31Here's how I arrived at the answer (c) increased blood [carbon dioxide]: The respiratory…
Q: 12. How many chromosomes are in a human body cell? 46 How many homologous pairs? 23 13. What are…
A: The human body cell contains 46 chromosomes. These chromosomes are arranged in 23 homologous pairs.
Q: 1. MEGA works differently than traditional CRISPR technology by targeting mRNA and NOT DNA…
A: Novel MEGA (mr RNA guiding endonuclease for genome editing) technology is one of CRISPR-C systems…
Q: What is the energy source of liquid liquid phase separation in biology and will this process reach…
A: Liquid-liquid phase separation (LLPS) is a process in which a homogenous solution separates into two…
Q: According to Jean Buridan’s equation, the momentum or “impetus” of an 88 kilogram mass moving at 5…
A: The objective of this question is to calculate the momentum or 'impetus' of an object with a given…
Q: 6. A woman of blood group AB marries a man of blood group A, whose father was group O. What is the…
A: As per bartleby Q&A guidelines, we can answer only one question. Hence, repost the remaining…
Q: In the podcast on scientific literature Prof Fraser talked about the difference between primary…
A: The objective of the question is to understand Prof Fraser's assessment of the difference between…
Q: If 80% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 60…
A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…
Q: < 4:04A March 22 3:13 PM Edit Question 7 The electron transport chain of chloroplasts is located in…
A: QUESTION 7Certainly! The location of the electron transport chain (ETC) in chloroplasts can be…
Q: The Christian doctrine of Jesus’ resurrection, and Philo Judaeus’ claim that a second birth is…
A: The question is asking us to identify the mythology that shares a common theme with the Christian…
Q: The campaign was designed to protect young women from men who preyed on the innocence of girls. Oage…
A: Step 1: The age of consent (the age at which a person is considered to have full legal capacity to…
Q: If the fifth Fibonacci number is 5, calculate the value of the 16th Fibonacci number. 233 377 610…
A: The objective of this question is to calculate the 16th Fibonacci number given that the fifth…
Q: Abraham, traditional founder of the nation of Israel, worshipped a single supreme supernatural…
A: The question is asking us to identify the religious doctrine that Abraham, the traditional founder…
Q: 6:00 A < March 22 3:13 PM Edit e) Large population size Question 46 (Mandatory) Speciation, the…
A: Allopatric speciation refers to the process by which a single population becomes *geographically…
Q: In your response explain how your species communication would potentially enhance the fitness of…
A: Understanding the complex tapestry of communication inside primate species gives an intriguing lens…
Q: Explain the difference between broad-spectrum and narrow-spectrum antibiotics.Give at least two…
A: Antibiotics fight bacterial infections, but they differ in how targeted they are. Here's the…
Q: Identify the pointed structure. a. Smooth Muscles b. Type 2 pneumocytes c. Alveolar macrophages d.…
A: Hi student. I hope this helps you. The pointed structure is identified as Type 2 pneumocytes. In…
Q: 1. Which, if, any of the drugs would you prescribe for a somewhat effective treatment of a patient…
A: 1. I would prescribe streptomycin and ciprofloxacin for somewhat effective treatment of a patient…
Q: Pollution is an abiotic factor. How did air pollution affect the light-colored peppered moths?…
A: The question is asking about the impact of air pollution, an abiotic factor, on the light-colored…
Q: Strato of Lampsacus, a student of Theophrastus in Aristotle’s Lyceum, made which of the following…
A: The question is asking about the contradiction made by Strato of Lampsacus, a student of…
Q: * The hypothalamic neurons that supply the structure that contain the asterisk: a. Synapse directly…
A: The question is asking about the characteristics of hypothalamic neurons that supply a certain…
Q: Name (Key Concept Builder Dala Clas tab LESSON 2 Renewable Energy Resources Key Concept What are the…
A: The objective of the question is to identify whether the given statements are advantages or…
Q: Question 94 (Mandatory) Duchenne muscular dystrophy is inherited in an X- linked recessive pattern.…
A: Duchenne Muscular Dystrophy (DMD) is an X-linked recessive condition, which implies the changed gene…
Q: There are two traits in moths: light color and dark color. If a population has 60%of the moths with…
A: The objective of the question is to predict the color distribution of the offspring in the next…
Q: The most recent monotheistic religion, originating after the fall of the Roman Empire, is:…
A: The question is asking us to identify the most recent monotheistic religion that originated after…
Q: Explain the concept of selective toxicity. Why antimicrobial drugs work best against bacteria which…
A: Antimicrobials are drugs that are used to prevent and cure infectious illnesses in people, plants,…
Q: What type of allele dominance is expressed in each of the Punnet Squares shown. Complete dominance,…
A: Allele dominance patterns affect how these traits are expressed in offspring and are essential in…
Q: 4. In Drosophila, a cross between two flies with short bristles yields 43 short and 25 normal. a.…
A: Within the study of genetics, Drosophila, commonly known as the fruit fly, is a model organism that…
Q: Two opposing mechanisms determine alveolar expansion:_________ leads to alveolar expansion,…
A: The objective of the question is to identify the two opposing mechanisms that determine alveolar…
Q: < 4:28 March 22 3:13 PM Edit activation energy free energy Question 17 In the fourth stage of…
A: Step 1:17.AThe question in the image is about embryonic development. Of the listed processes,…
Q: What is the difference between an indirect ELISA and a sandwich ELISA? Is rapid antibody testing a…
A: The objective of the question is to understand the differences between indirect ELISA and sandwich…
GQ11
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U A UUU UUC- UUA UUG- CUU CUC CUA CUG- AUU- ACU AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU GUC GCC GUA GCA GUG- GCG H₂N- U Phe (F) Leu (L) Leu (L) Nonpolar side chains; hydrophobic Val (V) Side chain (R group) H H₂N-C-C-0- HO Glycine (Gly or G) CH₂ H₂N*- CH₂ CH₂ H O Methionine (Met or M) Polar side chains; hydrophilic 0 CH₂ Second base in codon H O Aspartic acid (Asp or D) UCU UCC UCA UCG CCU CCC CCA CCG Alanine (Ala or A) OH CH₂ H₂N-C C 0 H₂N-C C 0 H O Serine (Ser or S) H O Threonine (Thr or T) Electrically charged side chains; hydrophilic OH CH3 CH -0- H₂N+- Acidic (negatively charged) CH₂ H₂N-C-C-O HO C Ser (S) Pro (P) CH₂ CH₂ Thr (T) CH₂ H₂N-C Ala (A)…6. You are performing site-directed mutagenesis to test predictions about which residues are critical for the function of a protein. Which of each pair of amino acid substitutions below would you expect to disrupt protein structure the most? Briefly explain your answers. (a) Ile replaced by Leu or Tyr (b) Val replaced by Ala or Phe (c) Lys replaced by Asp or Arg3. A missense mutation results in the presence of a different amino acid than was encoded by the parental sequence. This type of mutation can have a drastic effect or no effect at all depending on the importance of the amino acid and the type of amino acid that replaces it. Some amino acids are structurally similar and may be able to act as viable substitutes for each other. For example, changing one acidic amino acid to another may not affect the final protein, but changing a polar amino acid to a nonpolar amino acid will likely disrupt the structure. Please explain what mutations occur in HBB gene of abnormal hemoglobin and their effect on the function of the protein.
- 11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Lys. a. Provide one possible mRNA sequence for this peptide segment. b. Provide the corresponding tRNA anticodon for each amino acid. c. Provide the template DNA sequence for that mRNA. Table 1: Table of codons for amino acids. 1st position (5' end) C 2 G 2nd position (middle) U Phe F Phe F Leu L Leu L Leu L Leu L Leu L Leu L lle 1 lle 1 lle 1 START/Me tM Val V Val V Val V Val V. C Ser S Ser S Ser S Ser S Pro P Pro P Pro P Pro P The T The T The T The T Ala A Ala A Ala A Ala A Tyr Y Tyr Y STOP STOP His Hi His H Gln Q Gin Q Asa N Asa N Lys K Lys K Asp D Asp D Glu E Glu E G Cys C CVS C STOP Trp W Arg R Arg R Arg R Arg R Ser S Ser S Arg R Arg R Gly, G Saly, G Gly G G Gly *START codon signals the initiation of a peptide chain. *STOP codons signal the end of a peptide chain. 3rd position (3' end) JUAG C DURG C SCAG DUAG CDo you think each of the following types of mutationswould have very severe effects, mild effects, or no effectat all?a. Nonsense mutations occurring in the sequences encoding amino acids near the N terminus of the proteinb. Nonsense mutations occurring in the sequences encoding amino acids near the C terminus of the proteinc. Frameshift mutations occurring in the sequences encoding amino acids near the N terminus of the protein d. Frameshift mutations occurring in the sequencesencoding amino acids near the C terminus of theproteine. Silent mutationsf. Conservative missense mutationsg. Nonconservative missense mutations affecting theactive site of the proteinh. Nonconservative missense mutations not in the active site of the protein1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
- 5. A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBI) and into two different peptides by trypsin (Tryp). Their sequences were as follows: CNB 1: Gly-Thr-Lys-Ala-Glu CNBR 2: Ser-Met Tryp 1: Ser-Met-Gly-Thr-Lys Tryp 2: Ala-Glu What was the sequence of the original peptide?1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a different way you can determine reading frame. a. The following sequences of orthologous copies of the insulin receptor gene (INSR) from four species. The sequences are aligned but the reading frame is unknown. What is the reading frame for these sequences? (ie., Does the first complete codon begin at the first, second, or third nucleotide?) Hint: Think about what you know about the nature of mutations, natural selection and the genetic code. 1. Bear CCTGAAGAGCTACCICCGCICCCIGCGGCCGGAGGCTGAGAATAACCCCGGCCGCCCT 2. Human CCTGAAGAGCTACCICCGTICICIGCGGCCAGAGGCTGAGAATAATCCIGGCCGCCCI 3. Chicken CITGAAAAGCTACCIACGCTCICIGAGACCCGACGCIGAGAATAACCCTGGICGICCA 4. Cow CCTGAAGAGTTACCTCCGTTCCCIGCGGCCTGAGGCTGAGAATAACCCCGGCCGCCCT Answer:
- 6. In the following graph, the dashed line shows the level of mRNA for a certain protein, Prot6, at various positions along the anterior-posterior axis of an insect embryo. The solid lines portray the levels of two regulatory proteins, A and B, that control translation of the Prot6 mRNA. A В Position Biology: How Life Works, Second Edition © 2016 W.H. Freeman and Company If both A and B stimulate translation of the Prot6 mRNA, then which graph, from the ones shown below, best approximates the expected level of Prot6 across the embryo? Briefly justify your answer. M K Q Position Position Position Position Position Protein level MRNA level2. If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be minimally needed for each codon? а. 3 b. 4 С. 5 d. 6 е. 71. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) A 3' TACATGG'TTGTGCTAATT 5'